GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-03 19:53:02, GGRNA.v2 : RefSeq release 228 (Jan, 2025)

LOCUS       XM_018882803             591 bp    mRNA    linear   PLN 07-JAN-2024
DEFINITION  Sugiyamaella lignohabitans Yet3p (YET3), partial mRNA.
ACCESSION   XM_018882803
VERSION     XM_018882803.1
DBLINK      BioProject: PRJNA342695
            BioSample: SAMN04417247
KEYWORDS    RefSeq.
SOURCE      Sugiyamaella lignohabitans
  ORGANISM  Sugiyamaella lignohabitans
            Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina;
            Dipodascomycetes; Dipodascales; Trichomonascaceae; Sugiyamaella.
REFERENCE   1  (bases 1 to 591)
  AUTHORS   Bellasio,M., Peymann,A., Valli,M., Sipitzky,M., Graf,A., Sauer,M.,
            Marx,H. and Mattanovich,D.
  TITLE     Complete genome sequence and transcriptome regulation of the
            pentose utilising yeast Sugiyamaella lignohabitans
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 591)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (04-JAN-2024) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 591)
  AUTHORS   Peymann,A. and Graf,A.
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2016) Department of Biotechnology, University of
            Natural Resources and Life Sciences, Muthgasse 18, Vienna, Vienna
            1190, Austria
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NC_031672).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..591
                     /organism="Sugiyamaella lignohabitans"
                     /mol_type="mRNA"
                     /strain="CBS 10342"
                     /type_material="culture from holotype of Candida
                     lignohabitans"
                     /db_xref="taxon:796027"
                     /chromosome="A"
     gene            <1..>591
                     /gene="YET3"
                     /locus_tag="AWJ20_835"
                     /db_xref="GeneID:30037911"
     CDS             1..591
                     /gene="YET3"
                     /locus_tag="AWJ20_835"
                     /inference="similar to AA sequence:KEGG_Orthology:K14009"
                     /note="hypothetical protein; YET3 null mutant decreases
                     the level of secreted invertase; homolog of human BAP31
                     protein; protein abundance increases in response to DNA
                     replication stress; GO_component: GO:0005783 - endoplasmic
                     reticulum [Evidence IEA,IEA]; GO_component: GO:0005783 -
                     endoplasmic reticulum [Evidence IDA] [PMID 11914276];
                     GO_component: GO:0005783 - endoplasmic reticulum [Evidence
                     IDA] [PMID 20378542]; GO_component: GO:0005789 -
                     endoplasmic reticulum membrane [Evidence IEA];
                     GO_component: GO:0016021 - integral component of membrane
                     [Evidence IEA,IEA]; GO_component: GO:0016021 - integral
                     component of membrane [Evidence ISM] [PMID 12192589];
                     GO_component: GO:0016020 - membrane [Evidence IEA];
                     GO_function: GO:0003674 - molecular_function [Evidence
                     ND]; GO_process: GO:0008150 - biological_process [Evidence
                     ND]; GO_process: GO:0006886 - intracellular protein
                     transport [Evidence IEA]; GO_process: GO:0015031 - protein
                     transport [Evidence IEA]; GO_process: GO:0006810 -
                     transport [Evidence IEA]; GO_process: GO:0016192 -
                     vesicle-mediated transport [Evidence IEA]"
                     /codon_start=1
                     /product="Yet3p"
                     /protein_id="XP_018735055.1"
                     /db_xref="GeneID:30037911"
                     /translation="
MGAFLFLVTPLPRAYRKKVLTALSGLPFAHHLAITLRFTFIFILILFIDSVNRVYRVQVEVAEAHSSIRAAGNMISVERSEIQARKFYSQRNMYLCGFTLFLSLILNRTHALVLDLMEAQDKISALKGSSNDSVKAETLATEQKSEIARLEKELARKDQDLQTLKKQSEALSKEYHSVSDQLNAKSGSVPSDKKLD"
     misc_feature    1..378
                     /gene="YET3"
                     /locus_tag="AWJ20_835"
                     /note="Bap31/Bap29 transmembrane region; Region: Bap31;
                     pfam05529"
                     /db_xref="CDD:461673"
     misc_feature    433..582
                     /gene="YET3"
                     /locus_tag="AWJ20_835"
                     /note="Bap31/Bap29 cytoplasmic coiled-coil domain; Region:
                     Bap31_Bap29_C; pfam18035"
                     /db_xref="CDD:465623"
ORIGIN      
atgggagcattcctattcttggttacaccgttacctcgagcttatcgtaagaaggtattgactgctttatccggtctgccttttgctcaccacttagcgataaccttgagatttacttttatattcatactgatcctatttattgattcggtcaatcgagtgtacagagttcaagtcgaagttgccgaagctcacagttccattcgcgctgcggggaacatgatctctgtagaaagatctgagattcaggctcgcaagttctattcccaaagaaacatgtatttgtgtggcttcaccctgtttctatcattgattttaaacagaactcatgctcttgttcttgatttaatggaagctcaagacaaaatttctgctctcaagggaagctctaatgattccgtcaaagctgaaactcttgccactgaacaaaagtcagagattgctcgtcttgaaaaagagttggctcgtaaagaccaggatttgcaaactctgaagaagcagtctgaggcgctgtccaaagaatatcatagcgtcagtgatcaattgaatgctaagagtggttcagtaccttctgataagaaactagattag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]