GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-07-15 15:29:06, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       XM_018881652             873 bp    mRNA    linear   PLN 07-JAN-2024
DEFINITION  Sugiyamaella lignohabitans ADP/ATP carrier protein PET9 (PET9),
            partial mRNA.
ACCESSION   XM_018881652
VERSION     XM_018881652.1
DBLINK      BioProject: PRJNA342695
            BioSample: SAMN04417247
KEYWORDS    RefSeq.
SOURCE      Sugiyamaella lignohabitans
  ORGANISM  Sugiyamaella lignohabitans
            Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina;
            Dipodascomycetes; Dipodascales; Trichomonascaceae; Sugiyamaella.
REFERENCE   1  (bases 1 to 873)
  AUTHORS   Bellasio,M., Peymann,A., Valli,M., Sipitzky,M., Graf,A., Sauer,M.,
            Marx,H. and Mattanovich,D.
  TITLE     Complete genome sequence and transcriptome regulation of the
            pentose utilising yeast Sugiyamaella lignohabitans
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 873)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (04-JAN-2024) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 873)
  AUTHORS   Peymann,A. and Graf,A.
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2016) Department of Biotechnology, University of
            Natural Resources and Life Sciences, Muthgasse 18, Vienna, Vienna
            1190, Austria
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NC_031671).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..873
                     /organism="Sugiyamaella lignohabitans"
                     /mol_type="mRNA"
                     /strain="CBS 10342"
                     /type_material="culture from holotype of Candida
                     lignohabitans"
                     /db_xref="taxon:796027"
                     /chromosome="C"
     gene            <1..>873
                     /gene="PET9"
                     /locus_tag="AWJ20_4572"
                     /db_xref="GeneID:30036719"
     CDS             1..873
                     /gene="PET9"
                     /locus_tag="AWJ20_4572"
                     /inference="similar to AA sequence:KEGG_Orthology:K05863"
                     /note="Major ADP/ATP carrier of the mitochondrial inner
                     membrane; exchanges cytosolic ADP for mitochondrially
                     synthesized ATP; also imports heme and ATP;
                     phosphorylated; required for viability in many lab strains
                     that carry a sal1 mutation; PET9 has a paralog, AAC3, that
                     arose from the whole genome duplication; GO_component:
                     GO:0016021 - integral component of membrane [Evidence
                     IEA]; GO_component: GO:0016021 - integral component of
                     membrane [Evidence ISM] [PMID 12192589]; GO_component:
                     GO:0016020 - membrane [Evidence IEA]; GO_component:
                     GO:0005743 - mitochondrial inner membrane [Evidence
                     IEA,IEA,IEA]; GO_component: GO:0005743 - mitochondrial
                     inner membrane [Evidence IDA] [PMID 795470]; GO_component:
                     GO:0005739 - mitochondrion [Evidence IEA]; GO_component:
                     GO:0005739 - mitochondrion [Evidence IDA] [PMID 16823961];
                     GO_component: GO:0005739 - mitochondrion [Evidence IPI]
                     [PMID 16962558]; GO_function: GO:0005471 - ATP:ADP
                     antiporter activity [Evidence IDA] [PMID 8476415];
                     GO_function: GO:0005215 - transporter activity [Evidence
                     IEA]; GO_process: GO:0015866 - ADP transport [Evidence
                     IDA] [PMID 8476415]; GO_process: GO:0015867 - ATP
                     transport [Evidence IDA] [PMID 8476415]; GO_process:
                     GO:0009060 - aerobic respiration [Evidence IMP] [PMID
                     2167309]; GO_process: GO:0009061 - anaerobic respiration
                     [Evidence IGI] [PMID 1915842]; GO_process: GO:0006915 -
                     apoptotic process [Evidence IMP] [PMID 17822411];
                     GO_process: GO:0015886 - heme transport [Evidence IMP,IPI]
                     [PMID 18728780]; GO_process: GO:0006839 - mitochondrial
                     transport [Evidence IMP] [PMID 2167309]; GO_process:
                     GO:0055085 - transmembrane transport [Evidence IEA];
                     GO_process: GO:0055085 - transmembrane transport [Evidence
                     IDA] [PMID 8476415]; GO_process: GO:0006810 - transport
                     [Evidence IEA,IEA]"
                     /codon_start=1
                     /product="ADP/ATP carrier protein PET9"
                     /protein_id="XP_018734227.1"
                     /db_xref="GeneID:30036719"
                     /translation="
MGGVSAAVAKTAAAPIERVKLLIQNQDEMIKQGRLARKYDGIADAFRRTAAEEGIVSFWRGNTANVIRYFPTQALNFAFKDKFKALFGFKKSEGYWPWFAGNLASGGLAGATSLLFVYSLDYARTRLANDAKAAKGGGDREFNGLVDVYRKTLKSDGIAGLYRGFGPSVVGIIVYRGLYFGLYDSLKPVVLVGSLEGNFLASFLLGWTVTTGASTASYPLDTVRRRMMMTSGQAVKYKSSFDAFTKIVAAEGVTSLFKGCGANILRGVAGAGVISMYDQLQMILFGKKFK"
     misc_feature    1..852
                     /gene="PET9"
                     /locus_tag="AWJ20_4572"
                     /note="ADP/ATP transporter on adenylate translocase;
                     Provisional; Region: PTZ00169"
                     /db_xref="CDD:240302"
ORIGIN      
atgggaggtgtgtccgccgccgtcgctaagaccgccgctgcccccatcgagcgtgttaagcttcttatccaaaaccaagatgagatgatcaagcaaggtcgtcttgccagaaagtacgatggtattgccgatgctttccgtcgtactgctgctgaggaaggtattgtctctttctggagaggtaacactgctaacgttatccgttacttccccacccaagcccttaactttgccttcaaggataagttcaaggctctcttcggtttcaagaagtccgagggttactggccttggttcgccggtaacttggcttctggtggtcttgccggtgccacttctcttctcttcgtctactctcttgattacgcccgtactcgtcttgccaacgatgccaaggctgccaagggtggcggtgaccgtgagttcaacggtttggtcgatgtttacagaaagactctcaagtctgacggtattgccggtctctaccgtggtttcggtccctctgttgtcggtatcattgtctaccgtggtctttacttcggtctttacgattctcttaagcctgttgttcttgtcggttctcttgagggtaacttcttggcctctttcttgcttggttggaccgtcaccactggtgcctctactgcttcttatcctttggataccgtccgtcgtcgtatgatgatgacctctggtcaagccgttaagtacaagtcctctttcgacgctttcaccaagattgtcgccgctgagggtgttacttctctcttcaagggatgcggtgccaacattctccgtggtgttgccggtgctggtgttatctccatgtacgatcaattgcaaatgatcctcttcggtaagaagttcaaataa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]