2025-04-03 20:13:11, GGRNA.v2 : RefSeq release 228 (Jan, 2025)
LOCUS XM_018881437 807 bp mRNA linear PLN 07-JAN-2024 DEFINITION Sugiyamaella lignohabitans Thi73p (THI73), partial mRNA. ACCESSION XM_018881437 VERSION XM_018881437.1 DBLINK BioProject: PRJNA342695 BioSample: SAMN04417247 KEYWORDS RefSeq. SOURCE Sugiyamaella lignohabitans ORGANISM Sugiyamaella lignohabitans Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina; Dipodascomycetes; Dipodascales; Trichomonascaceae; Sugiyamaella. REFERENCE 1 (bases 1 to 807) AUTHORS Bellasio,M., Peymann,A., Valli,M., Sipitzky,M., Graf,A., Sauer,M., Marx,H. and Mattanovich,D. TITLE Complete genome sequence and transcriptome regulation of the pentose utilising yeast Sugiyamaella lignohabitans JOURNAL Unpublished REFERENCE 2 (bases 1 to 807) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (04-JAN-2024) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 807) AUTHORS Peymann,A. and Graf,A. TITLE Direct Submission JOURNAL Submitted (18-FEB-2016) Department of Biotechnology, University of Natural Resources and Life Sciences, Muthgasse 18, Vienna, Vienna 1190, Austria COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NC_031671). COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..807 /organism="Sugiyamaella lignohabitans" /mol_type="mRNA" /strain="CBS 10342" /type_material="culture from holotype of Candida lignohabitans" /db_xref="taxon:796027" /chromosome="C" gene <1..>807 /gene="THI73" /locus_tag="AWJ20_4373" /db_xref="GeneID:30036498" CDS 1..807 /gene="THI73" /locus_tag="AWJ20_4373" /note="Putative plasma membrane permease; proposed to be involved in carboxylic acid uptake and repressed by thiamine; substrate of Dbf2p/Mob1p kinase; transcription is altered if mitochondrial dysfunction occurs; GO_component: GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO_component: GO:0005783 - endoplasmic reticulum [Evidence IDA] [PMID 16850348]; GO_component: GO:0005789 - endoplasmic reticulum membrane [Evidence IEA]; GO_component: GO:0016021 - integral component of membrane [Evidence IEA,IEA]; GO_component: GO:0016021 - integral component of membrane [Evidence ISS] [PMID 10869563]; GO_component: GO:0016021 - integral component of membrane [Evidence ISM] [PMID 12192589]; GO_component: GO:0016020 - membrane [Evidence IEA]; GO_component: GO:0005886 - plasma membrane [Evidence IEA,IEA]; GO_function: GO:0005215 - transporter activity [Evidence ISS] [PMID 10869563]; GO_process: GO:0055085 - transmembrane transport [Evidence IEA]; GO_process: GO:0006810 - transport [Evidence IEA]; GO_process: GO:0006810 - transport [Evidence ISS] [PMID 10869563]" /codon_start=1 /product="Thi73p" /protein_id="XP_018734030.1" /db_xref="GeneID:30036498" /translation="
MLPNSPVDNKIFTEREKQIIIFRLKDNLTGIETKVFKWSQVKEVFFDPKTYFFFLISFFGNIPNGGLSNFGTLIIQGFGFSTLVTTLMQIPNGAVISGSILLAVFLNNRFKNRRVLFAVLFIIPNIVGAFGLYFIHDSHRIGRLICYYLTGPYNAAFVLLLSVTTANTAGHTKKVMTNAILFMGVCVGNIAGPFFYKTDQAPKYPLGMGSLIFSNISEAVLIAVLGLHLYRQNKKRDRDYPAQELDHDGTGAFLDLTDIQNKNFRYIY"
misc_feature <4..636 /gene="THI73" /locus_tag="AWJ20_4373" /note="Major Facilitator Superfamily; Region: MFS; cl28910" /db_xref="CDD:475125" ORIGIN
atgcttcccaattctcccgttgataacaaaatctttactgagagagagaagcagattattattttccgtcttaaggataatctaaccggtattgaaactaaagtgttcaaatggagccaagttaaggaagtgtttttcgatccaaagacgtatttcttcttcctcattagtttcttcggtaacattcccaacggcggtctttccaacttcggtaccctgattattcaaggtttcggtttctctactttagtcactactcttatgcagattcccaatggtgcagtcatttccggatctattctgttagctgtgtttttgaataacagatttaagaaccgtcgtgtgctgtttgctgttctgtttattattcccaacatagtcggtgcttttggtctgtactttattcacgacagtcaccgaatcggcagactcatctgttactacctgactggtccttataacgcagcgtttgtgctactgctatcggtgaccactgccaatactgccggccatactaagaaggtcatgaccaatgccattctgttcatgggggtctgtgtaggaaatattgctggtccatttttctacaagaccgaccaagctcctaaataccctcttggcatgggttctctcatcttctccaatatttctgaggccgtgctcattgccgtgttgggtctacatctctacagacaaaacaagaaacgcgacagagactatcctgctcaggaactcgaccatgatggaactggtgctttcttggatctgactgatatccagaataagaacttcagatacatctactag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]