GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-06-07 19:32:24, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       XM_018881096             951 bp    mRNA    linear   PLN 07-JAN-2024
DEFINITION  Sugiyamaella lignohabitans Pfa4p (PFA4), partial mRNA.
ACCESSION   XM_018881096
VERSION     XM_018881096.1
DBLINK      BioProject: PRJNA342695
            BioSample: SAMN04417247
KEYWORDS    RefSeq.
SOURCE      Sugiyamaella lignohabitans
  ORGANISM  Sugiyamaella lignohabitans
            Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina;
            Dipodascomycetes; Dipodascales; Trichomonascaceae; Sugiyamaella.
REFERENCE   1  (bases 1 to 951)
  AUTHORS   Bellasio,M., Peymann,A., Valli,M., Sipitzky,M., Graf,A., Sauer,M.,
            Marx,H. and Mattanovich,D.
  TITLE     Complete genome sequence and transcriptome regulation of the
            pentose utilising yeast Sugiyamaella lignohabitans
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 951)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (04-JAN-2024) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 951)
  AUTHORS   Peymann,A. and Graf,A.
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2016) Department of Biotechnology, University of
            Natural Resources and Life Sciences, Muthgasse 18, Vienna, Vienna
            1190, Austria
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NC_031671).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..951
                     /organism="Sugiyamaella lignohabitans"
                     /mol_type="mRNA"
                     /strain="CBS 10342"
                     /type_material="culture from holotype of Candida
                     lignohabitans"
                     /db_xref="taxon:796027"
                     /chromosome="C"
     gene            <1..>951
                     /gene="PFA4"
                     /locus_tag="AWJ20_4046"
                     /db_xref="GeneID:30036135"
     CDS             1..951
                     /gene="PFA4"
                     /locus_tag="AWJ20_4046"
                     /inference="similar to AA sequence:KEGG_Orthology:K18932"
                     /note="Palmitoyltransferase with autoacylation activity;
                     required for palmitoylation of amino acid permeases
                     containing a C-terminal Phe-Trp-Cys site; required for
                     modification of Chs3p; member of the DHHC family of
                     putative palmitoyltransferases; GO_component: GO:0005783 -
                     endoplasmic reticulum [Evidence IEA]; GO_component:
                     GO:0005783 - endoplasmic reticulum [Evidence IDA] [PMID
                     16647879]; GO_component: GO:0005789 - endoplasmic
                     reticulum membrane [Evidence IEA]; GO_component:
                     GO:0016021 - integral component of membrane [Evidence
                     IEA]; GO_component: GO:0016021 - integral component of
                     membrane [Evidence ISM] [PMID 12192589]; GO_component:
                     GO:0016020 - membrane [Evidence IEA]; GO_function:
                     GO:0046872 - metal ion binding [Evidence IEA];
                     GO_function: GO:0016409 - palmitoyltransferase activity
                     [Evidence IMP] [PMID 16818716]; GO_function: GO:0019706 -
                     protein-cysteine S-palmitoyltransferase activity [Evidence
                     IEA]; GO_function: GO:0016740 - transferase activity
                     [Evidence IEA]; GO_function: GO:0016746 - transferase
                     activity, transferring acyl groups [Evidence IEA];
                     GO_function: GO:0008270 - zinc ion binding [Evidence IEA];
                     GO_process: GO:0018345 - protein palmitoylation [Evidence
                     IMP] [PMID 16751107]; GO_process: GO:0018345 - protein
                     palmitoylation [Evidence IMP] [PMID 16818716]"
                     /codon_start=1
                     /product="Pfa4p"
                     /protein_id="XP_018733720.1"
                     /db_xref="GeneID:30036135"
                     /translation="
MTSPGSPTSDFKPLPGEWTRWCIKCNGYKPERTHHCRQCKKCVLKMDHHCPWTYNCVGHANMPHFVRFLAWVLISASYAFYHVWARGFFLYSKRHLPLSTYDVTKTEIAFTIVLIPVVSFVLFSVGLLSIRVAWNMVEGQTQIETWEVERIETLVRRKLVQNVEFPYDLDPWTNVANAMGGNNPLAWMWPFGGPVGDGMHFEKNEAADDGSVWPPDHRDQGPPRSGSAGASSSPSGDIGIRTAAPRGHYPRTLGYMRHRGNGEYAEDDGDDGYDSDSEDEEVERLPEENDFYKRDQWMNFEGESIADFGVDVDTES"
     misc_feature    <52..582
                     /gene="PFA4"
                     /locus_tag="AWJ20_4046"
                     /note="DHHC palmitoyltransferase; Region: DHHC; cl19890"
                     /db_xref="CDD:418707"
ORIGIN      
atgacctcgccaggaagcccaacatcggatttcaagccgcttcctggtgaatggaccaggtggtgtatcaagtgcaatggttataagcccgaaagaactcatcattgtagacagtgtaagaaatgtgtcttgaagatggaccaccattgtccttggacttataactgcgtgggtcatgccaatatgcctcactttgtgaggttcctagcttgggtgctcatatcggctagttacgcattctatcatgtatgggctagaggcttctttttgtactctaagcggcatcttcctctatcaacttatgatgtgactaaaaccgagattgcatttactattgtattgatcccagtggtttcatttgtcttgttctcagttggcttgctgtccatccgtgtcgcatggaacatggtcgagggtcagactcaaattgaaacatgggaggtcgaacgtattgaaactctcgttcgcagaaaactggtgcaaaatgtcgaatttccgtatgatttagatccgtggactaatgtagctaatgccatgggcggtaataatccgctggcatggatgtggccgtttggtgggcctgttggtgatggtatgcattttgagaaaaatgaggccgctgatgacggctctgtttggccacctgaccatcgagaccagggtcctcctcgttctgggtctgctggagcgtcatcctcgccgtccggggatatcggtataaggacagcggctccacgaggacactatcccagaacactggggtacatgcgccaccgtggtaatggtgagtatgccgaagacgatggagacgatggctatgacagtgattccgaagacgaagaagtcgaacgtcttcctgaagagaacgatttttacaagcgcgatcagtggatgaactttgagggcgagtccatcgccgatttcggtgtcgacgtcgatactgagagctag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]