2025-07-15 15:19:15, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS XM_018879594 942 bp mRNA linear PLN 07-JAN-2024 DEFINITION Sugiyamaella lignohabitans Nuc1p (NUC1), partial mRNA. ACCESSION XM_018879594 VERSION XM_018879594.1 DBLINK BioProject: PRJNA342695 BioSample: SAMN04417247 KEYWORDS RefSeq. SOURCE Sugiyamaella lignohabitans ORGANISM Sugiyamaella lignohabitans Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina; Dipodascomycetes; Dipodascales; Trichomonascaceae; Sugiyamaella. REFERENCE 1 (bases 1 to 942) AUTHORS Bellasio,M., Peymann,A., Valli,M., Sipitzky,M., Graf,A., Sauer,M., Marx,H. and Mattanovich,D. TITLE Complete genome sequence and transcriptome regulation of the pentose utilising yeast Sugiyamaella lignohabitans JOURNAL Unpublished REFERENCE 2 (bases 1 to 942) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (04-JAN-2024) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 942) AUTHORS Peymann,A. and Graf,A. TITLE Direct Submission JOURNAL Submitted (18-FEB-2016) Department of Biotechnology, University of Natural Resources and Life Sciences, Muthgasse 18, Vienna, Vienna 1190, Austria COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NC_031674). COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..942 /organism="Sugiyamaella lignohabitans" /mol_type="mRNA" /strain="CBS 10342" /type_material="culture from holotype of Candida lignohabitans" /db_xref="taxon:796027" /chromosome="B" gene <1..>942 /gene="NUC1" /locus_tag="AWJ20_2639" /db_xref="GeneID:30034572" CDS 1..942 /gene="NUC1" /locus_tag="AWJ20_2639" /inference="similar to AA sequence:KEGG_Orthology:K01173" /note="Major mitochondrial nuclease; has RNAse and DNA endo- and exonucleolytic activities; roles in mitochondrial recombination, apoptosis and maintenance of polyploidy; involved in fragmentation of genomic DNA during PND (programmed nuclear destruction); encodes ortholog of mammalian endoG; GO_component: GO:0016020 - membrane [Evidence IEA]; GO_component: GO:0005743 - mitochondrial inner membrane [Evidence IEA,IEA]; GO_component: GO:0005743 - mitochondrial inner membrane [Evidence IDA] [PMID 17244531]; GO_component: GO:0005743 - mitochondrial inner membrane [Evidence IDA] [PMID 3286639]; GO_component: GO:0005739 - mitochondrion [Evidence IEA]; GO_component: GO:0005739 - mitochondrion [Evidence IDA] [PMID 16823961]; GO_component: GO:0005634 - nucleus [Evidence IDA] [PMID 17244531]; GO_function: GO:0004520 - endodeoxyribonuclease activity [Evidence IDA] [PMID 3286639]; GO_function: GO:0004519 - endonuclease activity [Evidence IEA]; GO_function: GO:0004529 - exodeoxyribonuclease activity [Evidence IDA] [PMID 3286639]; GO_function: GO:0016787 - hydrolase activity [Evidence IEA,IEA]; GO_function: GO:0046872 - metal ion binding [Evidence IEA,IEA]; GO_function: GO:0004518 - nuclease activity [Evidence IEA]; GO_function: GO:0003676 - nucleic acid binding [Evidence IEA]; GO_function: GO:0004540 - ribonuclease activity [Evidence IDA] [PMID 3286639]; GO_process: GO:0006308 - DNA catabolic process [Evidence IDA] [PMID 3286639]; GO_process: GO:0006310 - DNA recombination [Evidence IMP] [PMID 8087883]; GO_process: GO:0006401 - RNA catabolic process [Evidence IDA] [PMID 3286639]; GO_process: GO:0006309 - apoptotic DNA fragmentation [Evidence IMP] [PMID 22727375]; GO_process: GO:0006915 - apoptotic process [Evidence IMP] [PMID 17244531]" /codon_start=1 /product="Nuc1p" /protein_id="XP_018737496.1" /db_xref="GeneID:30034572" /translation="
MLWGKKTETTTTTNTSEVVGTIPLTPELSRAGAVVRSSLVNPAEYFQKYGFPGPVHDIASREQFISCYDRKTRNPAWVIEHITGQSLKVRDGDRGSSIFKEDTAVPALFRGQLRDYFRSGYDRGHQAPAADAKFSQNAMDETFFLTNMCPQVGDGFNRDYWAHFEHFCRKLTDSYASVRIVTGPLYLPKKDSDGKWRVSYEVIGNPPNIAVPTHFFKIIVGENPSPALGSPKGVAIGAFVLPNEKIDNNTPLKSFYVPIESVERSTGVEFLPLLPASERRDLCREVKCEITVREFVKALPAPREQLALPPPRK"
misc_feature 181..831 /gene="NUC1" /locus_tag="AWJ20_2639" /note="DNA/RNA non-specific endonuclease; Region: NUC; smart00477" /db_xref="CDD:214683" misc_feature order(364..369,373..375,469..471,493..495,505..507) /gene="NUC1" /locus_tag="AWJ20_2639" /note="active site" /db_xref="CDD:238043" misc_feature order(364..369,505..507) /gene="NUC1" /locus_tag="AWJ20_2639" /note="substrate binding site [chemical binding]; other site" /db_xref="CDD:238043" misc_feature 469..471 /gene="NUC1" /locus_tag="AWJ20_2639" /note="Mg2+ binding site [ion binding]; other site" /db_xref="CDD:238043" ORIGIN
atgttgtggggtaaaaagaccgagactactaccactacgaacacttcggaggtggtggggaccattccattgactccagaactgtcccgggctggtgcagtagtgagatcgtcgttggtaaacccggcagagtattttcagaagtatggatttcctggaccagtgcacgatattgccagcagagaacagtttattagttgttatgaccgtaaaactcgcaatccagcatgggtaattgaacatattacgggacagtctttaaaggttcgagacggagatcgtggttcgagcatttttaaggaggatactgcagtaccagctctattccgcggtcagttacgagactatttccgcagtggttacgaccgtggccatcaggctccagctgctgatgctaaattttctcaaaatgccatggatgagaccttttttcttactaatatgtgtcctcaagtgggtgatgggttcaatcgtgactattgggctcattttgagcatttttgtcgtaagctcactgattcctatgcatcagtacgtattgttactggaccactttatttgcctaagaaggacagtgacggaaaatggcgtgtcagttatgaggtaattggaaatcctccaaatattgcagtacctacccatttttttaagatcattgtcggtgagaacccgtctcccgcattaggatcccccaagggagtcgcaattggcgcgtttgttcttcctaacgagaaaattgataacaacactccattaaagagcttttatgttcccattgagtctgttgagaggtcgacgggtgtggagttcctgccattactaccagcatccgaacgccgtgatctgtgtcgcgaggttaagtgtgaaatcactgtccgcgaatttgtaaaggcacttccggctccacgagaacaacttgctctgcctccaccaagaaaataa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]