GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-03 20:09:02, GGRNA.v2 : RefSeq release 228 (Jan, 2025)

LOCUS       XM_018879510            1392 bp    mRNA    linear   PLN 07-JAN-2024
DEFINITION  Sugiyamaella lignohabitans Ale1p (ALE1), partial mRNA.
ACCESSION   XM_018879510
VERSION     XM_018879510.1
DBLINK      BioProject: PRJNA342695
            BioSample: SAMN04417247
KEYWORDS    RefSeq.
SOURCE      Sugiyamaella lignohabitans
  ORGANISM  Sugiyamaella lignohabitans
            Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina;
            Dipodascomycetes; Dipodascales; Trichomonascaceae; Sugiyamaella.
REFERENCE   1  (bases 1 to 1392)
  AUTHORS   Bellasio,M., Peymann,A., Valli,M., Sipitzky,M., Graf,A., Sauer,M.,
            Marx,H. and Mattanovich,D.
  TITLE     Complete genome sequence and transcriptome regulation of the
            pentose utilising yeast Sugiyamaella lignohabitans
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 1392)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (04-JAN-2024) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 1392)
  AUTHORS   Peymann,A. and Graf,A.
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2016) Department of Biotechnology, University of
            Natural Resources and Life Sciences, Muthgasse 18, Vienna, Vienna
            1190, Austria
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NC_031674).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..1392
                     /organism="Sugiyamaella lignohabitans"
                     /mol_type="mRNA"
                     /strain="CBS 10342"
                     /type_material="culture from holotype of Candida
                     lignohabitans"
                     /db_xref="taxon:796027"
                     /chromosome="B"
     gene            <1..>1392
                     /gene="ALE1"
                     /locus_tag="AWJ20_2560"
                     /db_xref="GeneID:30034485"
     CDS             1..1392
                     /gene="ALE1"
                     /locus_tag="AWJ20_2560"
                     /inference="similar to AA sequence:KEGG_Orthology:K13519"
                     /note="Broad-specificity lysophospholipid acyltransferase;
                     part of MBOAT family of membrane-bound O-acyltransferases;
                     key component of Lands cycle; may have role in fatty acid
                     exchange at sn-2 position of mature glycerophospholipids;
                     GO_component: GO:0005783 - endoplasmic reticulum [Evidence
                     IEA]; GO_component: GO:0005783 - endoplasmic reticulum
                     [Evidence IDA] [PMID 14562095]; GO_component: GO:0005783 -
                     endoplasmic reticulum [Evidence IDA] [PMID 17890783];
                     GO_component: GO:0005789 - endoplasmic reticulum membrane
                     [Evidence IEA]; GO_component: GO:0016021 - integral
                     component of membrane [Evidence IEA]; GO_component:
                     GO:0016021 - integral component of membrane [Evidence ISM]
                     [PMID 12192589]; GO_component: GO:0043231 - intracellular
                     membrane-bounded organelle [Evidence IEA]; GO_component:
                     GO:0016020 - membrane [Evidence IEA]; GO_component:
                     GO:0031090 - organelle membrane [Evidence IEA];
                     GO_component: GO:0005840 - ribosome [Evidence IDA] [PMID
                     16702403]; GO_function: GO:0003841 -
                     1-acylglycerol-3-phosphate O-acyltransferase activity
                     [Evidence IEA]; GO_function: GO:0003841 -
                     1-acylglycerol-3-phosphate O-acyltransferase activity
                     [Evidence IGI,IMP] [PMID 17675291]; GO_function:
                     GO:0003841 - 1-acylglycerol-3-phosphate O-acyltransferase
                     activity [Evidence IMP] [PMID 17726007]; GO_function:
                     GO:0047184 - 1-acylglycerophosphocholine O-acyltransferase
                     activity [Evidence IEA]; GO_function: GO:0047184 -
                     1-acylglycerophosphocholine O-acyltransferase activity
                     [Evidence IMP] [PMID 17726007]; GO_function: GO:0047184 -
                     1-acylglycerophosphocholine O-acyltransferase activity
                     [Evidence IMP] [PMID 17951629]; GO_function: GO:0008374 -
                     O-acyltransferase activity [Evidence IDA,IMP] [PMID
                     17890783]; GO_function: GO:0016740 - transferase activity
                     [Evidence IEA]; GO_function: GO:0016746 - transferase
                     activity, transferring acyl groups [Evidence IEA];
                     GO_process: GO:0046474 - glycerophospholipid biosynthetic
                     process [Evidence IGI,IMP] [PMID 17675291]; GO_process:
                     GO:0046474 - glycerophospholipid biosynthetic process
                     [Evidence IMP] [PMID 17726007]; GO_process: GO:0046474 -
                     glycerophospholipid biosynthetic process [Evidence IMP]
                     [PMID 17890783]; GO_process: GO:0006629 - lipid metabolic
                     process [Evidence IEA]; GO_process: GO:0008654 -
                     phospholipid biosynthetic process [Evidence IEA]"
                     /codon_start=1
                     /product="Ale1p"
                     /protein_id="XP_018737420.1"
                     /db_xref="GeneID:30034485"
                     /translation="
MGHLFINHVEAQIKPDFDVNVIDITGAQMVLCMKLSSFGWNVYDGTLSESSLSELQKDRAVRKHPSLIEFLSYAFFFPSLMTGPSYDYMEFARWMDLSMFDVIHKKASGDTIVKRRIPRSGRVATKKLVQGILWIVLWTQITNYISLEYAQSDKFTVELPFIVRAFYLYALGITYRLKYYGAWTISEGACILSGLGFNGKYTNPKTGKTKYLWNRVQNIDPWAFETGQNTHILLAAWNMNTNKWLKNYVYLRVTPKGRKPGFRSTLATFVTSALWHGTRPGYYLTFVGGAFFQSVGKLFRRNLRPIFVSADGVTPGPYKVYYDITCFVVTQLAFGYIVQPFIILDLKPSLAMWASVYYYVHIAIAISMFLFLGPPKKYITKALKKLQPVPLSHSEQIKIDSLRLKQIKADLDILTSQTSLGIPQPDIDHLDDEIHDAIREMDELRADLIQQLQDFRATHPAHR"
     misc_feature    1..1278
                     /gene="ALE1"
                     /locus_tag="AWJ20_2560"
                     /note="membrane-bound O-acyltransferase family; Region:
                     MBOAT; cl00738"
                     /db_xref="CDD:445070"
ORIGIN      
atgggccatttgtttattaatcatgttgaggcacagatcaagccggatttcgatgttaatgtcattgatataaccggtgctcagatggtcttgtgtatgaaactcagttcgtttggctggaatgtgtacgatggcacgctgtcagaatctagtctgtcggaattacaaaaagaccgggcagttcgaaaacacccgtcattgattgagtttttgtcatacgcttttttcttcccgtctcttatgacaggcccgtcttatgactatatggagtttgctcgctggatggatctgtccatgttcgatgtcattcataagaaagctagtggtgatactattgtaaagcgacggatccctcgtagtggtcgtgtggccaccaagaaactggtgcagggaatcctgtggatcgtgctatggacccagatcacgaactatatttctcttgagtacgctcaatctgataagttcactgtagaattgccatttattgtgcgtgctttctatctgtacgcactaggtatcacatacagactgaaatattacggtgcttggacaatttccgagggcgcgtgtattctcagtggattaggattcaacgggaaatataccaatcccaagaccggtaagaccaagtatctatggaacagggtgcaaaatatcgacccttgggcctttgaaacgggtcagaatactcatatcctgttggcagcctggaacatgaacactaataaatggctgaaaaactatgtgtatctccgagtgactcctaagggccgtaaacccgggttcagaagtactttagctacatttgtgacttctgctctgtggcatggaacaagaccgggatattatctgacatttgtcggaggtgcatttttccagtctgtaggcaaacttttcagacgaaaccttcgtcccatctttgtatctgctgacggagtcactcctggtccatataaagtgtattacgacattacctgttttgtggtgacacagttggcatttggatacattgtccaacccttcattatcctggacctgaaaccatcattggccatgtgggcatctgtatactactacgtccacatcgcaatagcaatttcaatgttccttttccttggacctccaaagaaatatatcaccaaagcacttaagaaactacagccagtaccattatcacacagcgaacaaatcaagatcgattcactacgactcaaacaaatcaaggccgacctcgacattctcacaagccagacgtcactgggaatcccccaacccgacattgaccacctcgatgacgaaatccatgacgccatccgcgaaatggacgagctccgagccgacctcatccagcaactccaggacttccgggccacccacccggctcaccgctaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]