ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-21 07:34:49, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XM_018878691 603 bp mRNA linear PLN 07-JAN-2024
DEFINITION Sugiyamaella lignohabitans Spt14p (SPT14), partial mRNA.
ACCESSION XM_018878691
VERSION XM_018878691.1
DBLINK BioProject: PRJNA342695
BioSample: SAMN04417247
KEYWORDS RefSeq.
SOURCE Sugiyamaella lignohabitans
ORGANISM Sugiyamaella lignohabitans
Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina;
Dipodascomycetes; Dipodascales; Trichomonascaceae; Sugiyamaella.
REFERENCE 1 (bases 1 to 603)
AUTHORS Bellasio,M., Peymann,A., Valli,M., Sipitzky,M., Graf,A., Sauer,M.,
Marx,H. and Mattanovich,D.
TITLE Complete genome sequence and transcriptome regulation of the
pentose utilising yeast Sugiyamaella lignohabitans
JOURNAL Unpublished
REFERENCE 2 (bases 1 to 603)
CONSRTM NCBI Genome Project
TITLE Direct Submission
JOURNAL Submitted (04-JAN-2024) National Center for Biotechnology
Information, NIH, Bethesda, MD 20894, USA
REFERENCE 3 (bases 1 to 603)
AUTHORS Peymann,A. and Graf,A.
TITLE Direct Submission
JOURNAL Submitted (18-FEB-2016) Department of Biotechnology, University of
Natural Resources and Life Sciences, Muthgasse 18, Vienna, Vienna
1190, Austria
COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final
NCBI review. This record is derived from an annotated genomic
sequence (NC_031672).
COMPLETENESS: incomplete on both ends.
FEATURES Location/Qualifiers
source 1..603
/organism="Sugiyamaella lignohabitans"
/mol_type="mRNA"
/strain="CBS 10342"
/type_material="culture from holotype of Candida
lignohabitans"
/db_xref="taxon:796027"
/chromosome="A"
gene <1..>603
/gene="SPT14"
/locus_tag="AWJ20_1785"
/db_xref="GeneID:30033625"
CDS 1..603
/gene="SPT14"
/locus_tag="AWJ20_1785"
/inference="similar to AA sequence:KEGG_Orthology:K03857"
/note="UDP-glycosyltransferase subunit of the GPI-GnT
complex; UDP-GlcNAc-binding and catalytic subunit of the
enzyme that mediates the first step in
glycosylphosphatidylinositol (GPI) biosynthesis, mutations
cause defects in transcription and in biogenesis of cell
wall proteins; GO_component: GO:0005783 - endoplasmic
reticulum [Evidence IEA]; GO_component: GO:0005783 -
endoplasmic reticulum [Evidence IMP] [PMID 9079905];
GO_component: GO:0005789 - endoplasmic reticulum membrane
[Evidence IEA]; GO_component: GO:0000506 -
glycosylphosphatidylinositol-N-
acetylglucosaminyltransferase (GPI-GnT) complex [Evidence
TAS] [PMID 11102867]; GO_component: GO:0016021 - integral
component of membrane [Evidence IEA]; GO_component:
GO:0016020 - membrane [Evidence IEA]; GO_function:
GO:0008194 - UDP-glycosyltransferase activity [Evidence
ISS] [PMID 10970797]; GO_function: GO:0017176 -
phosphatidylinositol N-acetylglucosaminyltransferase
activity [Evidence IEA]; GO_function: GO:0016740 -
transferase activity [Evidence IEA]; GO_function:
GO:0016757 - transferase activity, transferring glycosyl
groups [Evidence IEA]; GO_process: GO:0006506 - GPI anchor
biosynthetic process [Evidence IEA,IEA,IEA]; GO_process:
GO:0006506 - GPI anchor biosynthetic process [Evidence
ISS] [PMID 8081362]; GO_process: GO:0009058 - biosynthetic
process [Evidence IEA]"
/codon_start=1
/product="Spt14p"
/protein_id="XP_018735969.1"
/db_xref="GeneID:30033625"
/translation="
MREKFRLQERVDLIGSIRHEMVREVMVSGHIYLHPTLTEAFGTVIVEAASCGLLVVTTKVGGIPEVLPSHMTVFASPSEDSLVDSTLHAISLIENKRIDTYLFHEEIKGMYCWEDVAERTEAVYDHISKTVRDDEPLVERLQKYYRCGPWAGKLFVVCIIVDTLFYLFLQWFWPEELIDRAKKWPKKIVNCDLTESQKKD"
misc_feature <1..477
/gene="SPT14"
/locus_tag="AWJ20_1785"
/note="glycosyltransferase family 1 and related proteins
with GTB topology; Region: Glycosyltransferase_GTB-type;
cl10013"
/db_xref="CDD:471961"
ORIGIN
atgagggaaaagtttcgcttacaggaaagagtagatttaataggaagtattcgacatgaaatggttcgggaggtcatggtttctggtcatatttacttgcatcctactttaacagaagcatttggcaccgtgattgttgaagctgcttcttgtggactattagttgtcacaactaaagtaggaggaattcccgaagtgctaccttcccatatgactgtattcgcgtccccgtctgaagactcgttggtagacagtacacttcatgcgatatctttgattgaaaacaaaagaatagatacctatctcttccatgaagagattaagggtatgtactgttgggaagacgtagcggaaagaactgaggcggtgtatgatcatataagcaagaccgtaagggatgacgagccattggtagagaggctgcagaaatattatcgttgtggcccatgggcaggaaagctctttgtcgtctgcattatcgttgatactttgttttacttatttcttcagtggttctggcccgaagagcttattgacagagctaagaaatggccgaaaaaaattgtgaactgtgacttgactgaatcccagaaaaaagattaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]