GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-04 14:24:58, GGRNA.v2 : RefSeq release 228 (Jan, 2025)

LOCUS       XM_017877085            3442 bp    mRNA    linear   PRI 24-AUG-2016
DEFINITION  PREDICTED: Rhinopithecus bieti nuclear factor kappa B subunit 1
            (NFKB1), transcript variant X1, mRNA.
ACCESSION   XM_017877085
VERSION     XM_017877085.1
DBLINK      BioProject: PRJNA339282
KEYWORDS    RefSeq.
SOURCE      Rhinopithecus bieti (black snub-nosed monkey)
  ORGANISM  Rhinopithecus bieti
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Cercopithecidae; Colobinae; Rhinopithecus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_016806622.1) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Rhinopithecus bieti Annotation
                                           Release 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3442
                     /organism="Rhinopithecus bieti"
                     /mol_type="mRNA"
                     /isolate="Rb0"
                     /db_xref="taxon:61621"
                     /chromosome="Unknown"
                     /sex="male"
                     /tissue_type="blood"
     gene            1..3442
                     /gene="NFKB1"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 mRNA, 271 ESTs, 5 Proteins, and
                     100% coverage of the annotated genomic feature by RNAseq
                     alignments, including 6 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:108532817"
     CDS             1..2937
                     /gene="NFKB1"
                     /codon_start=1
                     /product="nuclear factor NF-kappa-B p105 subunit isoform
                     X1"
                     /protein_id="XP_017732574.1"
                     /db_xref="GeneID:108532817"
                     /translation="
MGLATPGFRMAEDDPYLGRPEQMFHLDPSLTHTIFNPEVFQPQMALPTADGPYLQILEQPKQRGFRFRYVCEGPSHGGLPGASSEKNKKSYPQVKICNYVGPAKVIVQLVTNGKNIHLHAHSLVGKHCEDGICTVTAGPKDMVVGFANLGILHVTKKKVFETLEARMTEACIRGYNPGLLVHPDLAYLQAEGGGDRQLGDREKELIRQAALQQTKEMDLSVVRLMFTAFLPDSTGSFTRRLEPVVSDAIYDSKAPNASNLKIVRMDRTAGCVTGGEEIYLLCDKVQKDDIQIRFYEEEENGGVWEGFGDFSPTDVHRQFAIVFKTPKYKDVNITKPASVFVQLRRKSDLETSEPKPFLYYPEIKDKEEVQRKRQKLMPNFSDSFGGGSGAGAGGGGMFGSGGGGGGTGSTGPGYSFPHYGFPTYGGITFHPGTTKSNAGMKHGTMDTESKKDSEGCDRSDDRNTVNLFGKVVETTEHNQEPSEATDGNGEVTLTYATRAKEESARVQDNLFLEKAMQLAKRHANALFDYAVTGDVKMLLAVQRHLTAVQDENGDSVLHLAIIHLHSQLVRDLLEVTSGLISDDIINMRNDLYQTPLHLAVITKQEDVVEDLLRAGADLSLLDRLGNSVLHLAAKEGHDKVLSILLKHKKAALLLDHPNGDGLNAIHLAMMSNSLPCLLLLVAAGADVNAQEQKSGRTALHLAVEHDNISLAGCLLLEGDAHVDSTTYDGTTPLHIAAGRGSTRLAALLKAAGADPLVENFEPLYDLDDSWENAGEDEGVVPGTTPLDMAASWQVFDILNGKPYEPEFTSDDLLAQGDMKQLAEDVKLQLYKLLEIPDPDKNWATLAQKLGLGILNNAFRLSPAPSKTLMDNYEVSGGTVRELVEALRQMGYTEAIEVIQAASSPVKTTSQAHSLPLLPASTRQQIDELRDSDSVCDSGVETSFRKLSFTESLTSGGSLLTLNKMPHDYGQEGPLEGKI"
     misc_feature    154..759
                     /gene="NFKB1"
                     /note="N-terminal sub-domain of the Rel homology domain
                     (RHD) of nuclear factor of kappa B1 (NF-kappa B1); Region:
                     RHD-n_NFkB1; cd07935"
                     /db_xref="CDD:143651"
     misc_feature    order(196..198,202..207,211..216,223..234,457..459,
                     463..468,757..759)
                     /gene="NFKB1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:143651"
     misc_feature    778..1083
                     /gene="NFKB1"
                     /note="IPT domain of the transcription factor NFkappaB and
                     related transcription factors. NFkappaB is considered a
                     central regulator of stress responses, activated by
                     different stressful conditions, including physical stress,
                     oxidative stress, and exposure to...; Region:
                     IPT_NFkappaB; cd01177"
                     /db_xref="CDD:238582"
     misc_feature    order(781..783,787..795,799..807,925..933,970..972,
                     1006..1008,1063..1065,1072..1074,1078..1080)
                     /gene="NFKB1"
                     /note="ankyrin protein binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:238582"
     misc_feature    order(787..792,796..798,835..837,841..843,847..849,
                     946..951,958..960,964..966)
                     /gene="NFKB1"
                     /note="dimerization interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:238582"
     misc_feature    order(850..852,856..858,949..954)
                     /gene="NFKB1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238582"
     misc_feature    1522..2304
                     /gene="NFKB1"
                     /note="Ankyrin repeat [Signal transduction mechanisms];
                     Region: ANKYR; COG0666"
                     /db_xref="CDD:440430"
     misc_feature    order(1654..1656,1660..1662,1672..1677,1684..1692,
                     1696..1701,1711..1713,1720..1722,1765..1767,1771..1773,
                     1777..1779,1789..1794,1801..1809,1813..1818,1828..1830,
                     1837..1839,1864..1866,1870..1872,1876..1878,1888..1893,
                     1900..1908,1912..1917,1927..1929,1936..1938)
                     /gene="NFKB1"
                     /note="oligomer interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:293786"
     misc_feature    1654..1767
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    1771..1866
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    1978..2070
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2080..2178
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2473..2700
                     /gene="NFKB1"
                     /note="Death domain of the Nuclear Factor-KappaB1
                     precursor protein p105; Region: Death_NFkB1_p105; cd08797"
                     /db_xref="CDD:260063"
ORIGIN      
atgggattggcgacaccgggcttcagaatggcagaggatgatccatatttgggaaggcctgaacaaatgtttcatttggatccttctttgactcatacaatatttaatccagaagtatttcaaccacagatggcactgccaacagcagatggcccatatcttcaaatattagagcaacctaaacagagaggatttcgtttccgttatgtttgtgaaggcccatcccatggtggactacctggtgcctctagcgaaaagaacaagaagtcttaccctcaggtcaaaatctgcaactatgtgggaccagcaaaggttattgttcagttggtcacaaatggaaaaaatatccacctgcatgcccacagcctggtgggaaaacactgtgaggatgggatctgcactgtaactgctggacccaaggacatggtggtcggcttcgcaaacctgggtatacttcatgtgacaaagaaaaaagtatttgaaacactggaagcacgaatgacagaggcgtgtataaggggctataatcctggactcttggtgcaccctgaccttgcctatttgcaagcagaaggtggaggggaccggcagttgggagatcgggaaaaagagctaatccgccaagcagctctgcagcaaaccaaggagatggacctcagcgtggtacggctcatgtttacagcttttcttccggatagcactggcagcttcacaaggcgcctggaacccgtggtatcagatgccatctatgacagtaaagcccccaatgcatccaacttgaaaattgtaagaatggacaggacagctggatgtgtgactggaggggaggaaatttatcttctctgtgacaaagttcagaaagatgacatccagattcgattttatgaagaggaggaaaatggcggagtctgggaaggatttggagatttttcccccacagatgttcatagacaatttgccatcgtcttcaaaactccaaagtataaagatgttaatattacgaaaccagcctctgtgttcgtacagcttcggaggaaatctgacttggaaactagtgaaccaaaacctttcctctactatcctgaaatcaaagataaagaagaagtacagaggaaacggcagaagctcatgcccaatttttcggatagtttcggcggtgggagtggcgctggagctggaggcggaggcatgtttggtagtggcggtggaggagggggcactggaagtacagggccagggtatagcttcccgcactatggatttcctacttatggtgggattaccttccatcctggaactactaaatctaatgctgggatgaagcatggaaccatggacactgaatctaaaaaggactctgaaggttgtgacagaagtgatgacagaaacactgtaaacctctttgggaaagtcgttgaaaccacagagcacaatcaggagcccagcgaggccactgatgggaatggtgaggtcactctaacgtatgcaacaagagcaaaagaagagagtgctagggttcaggataacctctttctagagaaggctatgcagcttgcaaagaggcatgccaatgcccttttcgactacgccgtgacaggagacgtgaagatgctgctggccgtccagcgccatctcactgccgtgcaggatgagaatggggacagtgtcttacacttagcaatcatccaccttcattctcaacttgtgagggatctactagaagtcacatctggtttgatttctgatgacattatcaacatgagaaatgacctgtaccagacgcccttgcacttggcagtgatcactaagcaggaagatgtggtggaggatttgctgagggctggggccgacctgagccttctggaccgcttgggtaactctgttttgcacctagctgccaaagaaggacatgataaagttctcagtatcttactcaagcacaaaaaggcagcactacttcttgaccaccccaatggggacggtctgaatgccattcatctagccatgatgagcaatagcctgccatgtttgctgctgctggtggccgctggggccgacgtcaatgctcaggagcaaaagtccgggcgcacagcactgcacctggctgtggagcacgacaacatctcattggcaggctgcctgctcctggagggtgacgcccatgtggacagtactacctacgatggaaccacacccctgcatatagcagctgggagagggtccaccaggctggcagctcttctcaaagcagcaggagcagatcccctggtggagaactttgagcctctctatgacctggatgactcttgggaaaatgcaggagaggatgaaggagttgtgcctggaaccacgcctctagatatggccgccagctggcaggtatttgacatattaaatgggaaaccatatgagccagagtttacatctgatgatttactagcacaaggagacatgaaacagctggctgaagatgtgaagctgcagctctataagttgctagaaattcctgatccagacaaaaactgggctactctggcacagaaattaggcctggggatacttaataatgccttccggctgagtcctgctccttccaaaacacttatggacaactatgaggtctctggagggacagtcagagagctggtggaggctctgagacaaatgggctacactgaagcgattgaagtgatccaggcagcctccagcccagtgaagaccacctctcaggcccactcgctgcctctcttgcctgcctccacaaggcagcaaatagatgagctccgagacagcgacagtgtctgcgacagcggcgtggagacgtccttccgcaaactcagctttactgagtctctgaccagtggtggctcactgctaactctcaacaaaatgccccatgattatgggcaggaaggacctctagaaggcaaaatttagcctgctgacaatttcccacaccgtataaaccaaagccctaaaattctactgcattgtccacaaaacagaagctgaagcgcatccagaggtgctcagagagccagcctgcctgaatcattctcgatataactcgagaccttttcaacttggcttcctttcttggttcataaacgaattttagtttggttcacttacagatagtatctagcaatcacagcactggctgagtggatgcatctggggatgaggttgcttactaagctttgccggctgctgccggatcacagctgctttctgttgtcattgcttttgtccctctgctacgttcctattgtcattaaaggtatcactgtctccacctggcattccttctgaccatccacaacatcgttttgcattcaaattaagggttaagaaaagggatattttaaaatgagagtcacttgacgtgccattttaaaaaaaagcatattgctttttctaatgtggttatttctctgatttg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]