2025-08-18 18:02:13, GGRNA.v2 : RefSeq release 230 (May, 2025)
LOCUS XM_017508662 3835 bp mRNA linear PRI 20-NOV-2020 DEFINITION PREDICTED: Cebus imitator nuclear factor kappa B subunit 1 (NFKB1), transcript variant X2, mRNA. ACCESSION XM_017508662 VERSION XM_017508662.2 DBLINK BioProject: PRJNA328123 KEYWORDS RefSeq. SOURCE Cebus imitator (Panamanian white-faced capuchin) ORGANISM Cebus imitator Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Platyrrhini; Cebidae; Cebinae; Cebus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_016107712.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Nov 18, 2020 this sequence version replaced XM_017508662.1. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Cebus imitator Annotation Release 101 Annotation Version :: 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.5 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3835 /organism="Cebus imitator" /mol_type="mRNA" /isolate="Cc_AM_T3" /db_xref="taxon:2715852" /chromosome="Unknown" /sex="male" /dev_stage="adult" /geo_loc_name="Costa Rica" gene 1..3835 /gene="NFKB1" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 4 mRNAs, 267 ESTs, 5 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 26 samples with support for all annotated introns" /db_xref="GeneID:108289254" CDS 432..3335 /gene="NFKB1" /codon_start=1 /product="nuclear factor NF-kappa-B p105 subunit isoform X2" /protein_id="XP_017364151.1" /db_xref="GeneID:108289254" /translation="
MAEDDPYLGRPEQMFHLDPLTHTIFNPEVFQPQMALPTDGPYLQILEQPKQRGFRFRYVCEGPSHGGLPGASSEKNKKSYPQVKICNYVGPAKVIVQLVTNGKNTHLHAHSLVGKHCEDGICTVTAGPKDMVVGFANLGILHVTKKKVFETLEARMTEACIRGYNPGLLVHPDLAYLQAEGGGDRQLGDREKELIRQAALQQTKEMDLSVVRLMFTAFLPDSTGSFTRRLEPVVSDAIYDSKAPNASNLKIVRMDRTAGCVTGGEEIYLLCDKVQKDDIQIRFYEEEENGGVWEGFGDFSPTDVHRQFAIVFKTPKYKDVNITKPASVFVQLRRKSDLETSEPKPFLYYPEIKDKEEVQRKRQKLMPNFSDSFGGGSGAGAGGGGMFGSGGGGGGTGSTGPGYSFPHYGFPTYGGITFHPGTTKSNAGMKHGTMDSESKKDPEGCDKSDDRDTVNLFGKVTETTEQDQEPSKATDGNGEVALTYATETKEESAGVQDNLFLEKAMQLAKRHANALFDYAVTGDVKMLLAVQRHLTAVQDENGDSVLHLAIIHLHSQLVRDLLEVTSGLISDDIINMRNDLYQTPLHLAVITKQENVVEDLLRAGADLSLLDRFGNSVLHLAAKEGNDKVLSILLKHKKAALLLDHPNGDGLNAIHLAMMSNSLPCLLLLVAAGANVNAQEQKSGRTALHLAVEHDNISLAGCLLLEGDAHVDSTTYDGTTPLHIAAGRGSTRLAALLKAAGADPLVENFEPLYDLDDSWENAGEDEGVVPGTTPLDMATSWQVFDILNGKPYEPEFTSDDLLAQGDMKQLAEDVKLQLYKLLEIPDPDKNWATLAQKLGLGILNNAFRLSPAPSKTLMDNYEVSGGTVRELVEALRQMGYTEAVEVIQAASSPVKTTSQAHSLPLSPASTRQQIDELRDSDSVCDSGVETSFHRLSFTESLTSGGSLLTLNKMPHDYGQEGPLEGKI"
misc_feature 552..1157 /gene="NFKB1" /note="N-terminal sub-domain of the Rel homology domain (RHD) of nuclear factor of kappa B1 (NF-kappa B1); Region: RHD-n_NFkB1; cd07935" /db_xref="CDD:143651" misc_feature order(594..596,600..605,609..614,621..632,855..857, 861..866,1155..1157) /gene="NFKB1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:143651" misc_feature 1176..1481 /gene="NFKB1" /note="IPT domain of the transcription factor NFkappaB and related transcription factors. NFkappaB is considered a central regulator of stress responses, activated by different stressful conditions, including physical stress, oxidative stress, and exposure to...; Region: IPT_NFkappaB; cd01177" /db_xref="CDD:238582" misc_feature order(1179..1181,1185..1193,1197..1205,1323..1331, 1368..1370,1404..1406,1461..1463,1470..1472,1476..1478) /gene="NFKB1" /note="ankyrin protein binding site [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(1185..1190,1194..1196,1233..1235,1239..1241, 1245..1247,1344..1349,1356..1358,1362..1364) /gene="NFKB1" /note="dimerization interface [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(1248..1250,1254..1256,1347..1352) /gene="NFKB1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238582" misc_feature 1920..2702 /gene="NFKB1" /note="Ankyrin repeat [Signal transduction mechanisms]; Region: ANKYR; COG0666" /db_xref="CDD:440430" misc_feature order(2052..2054,2058..2060,2070..2075,2082..2090, 2094..2099,2109..2111,2118..2120,2163..2165,2169..2171, 2175..2177,2187..2192,2199..2207,2211..2216,2226..2228, 2235..2237,2262..2264,2268..2270,2274..2276,2286..2291, 2298..2306,2310..2315,2325..2327,2334..2336) /gene="NFKB1" /note="oligomer interface [polypeptide binding]; other site" /db_xref="CDD:293786" misc_feature 2052..2165 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2169..2264 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature order(2376..2378,2382..2384,2394..2399,2406..2414, 2418..2423,2433..2435,2442..2444,2469..2471,2478..2480, 2484..2486,2496..2501,2508..2516,2520..2525,2538..2540, 2547..2549,2574..2576,2580..2582,2586..2588,2598..2603, 2610..2618,2622..2624) /gene="NFKB1" /note="oligomer interface [polypeptide binding]; other site" /db_xref="CDD:293786" misc_feature 2376..2471 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2478..2576 /gene="NFKB1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2871..3098 /gene="NFKB1" /note="Death domain of the Nuclear Factor-KappaB1 precursor protein p105; Region: Death_NFkB1_p105; cd08797" /db_xref="CDD:260063" ORIGIN
gcaccagcgagccggggcaggaagaggaggtttcgccaccggagcggcccggcgacgcgctgacagcttcccctgcccttcccgtcggtcgggccgccagccgccgccgccctcggcctgcacgccgccgccagccccgctcccggagcccagcgccgccgaggccgcagccgcccggccaggaaggcggcgccgccgcccggccacagcgcgccctgcgcttccctccgcccgcgctgcggacatggcgcggcgctgactggcccagcctggccccgctgcgctctctctcgccccgacccacacccgggcccgctcgggctccggccggccgccgcctcttccttctccagcttttaggcccgcgccgcccgggagggagagcccacccgcgacagaggccgaacgctgactcgccacccggcttcagaatggcagaagatgatccatatttgggaaggcctgaacaaatgtttcatttggatcctttgactcatacaatatttaatccagaagtatttcaaccacagatggcactgccaacagatggcccataccttcaaatattagagcaacctaaacagagaggatttcgtttccgttacgtatgtgaaggcccatcccatggtggactacctggtgcctctagcgaaaagaacaagaagtcttaccctcaggtcaaaatctgcaactatgtgggaccagcaaaggttattgttcagttggtcacaaatggaaaaaatacccacctgcatgcccacagcctggtgggaaaacactgtgaggatgggatctgcactgtaactgctggacccaaggacatggtggtcggctttgcaaacttgggtatacttcatgtgacaaagaaaaaagtatttgaaacactggaagcgcgaatgacagaggcgtgtataaggggctacaatcccggactcttggtgcaccctgaccttgcgtatttgcaagcagaaggtggaggggaccggcagctgggagatcgggaaaaagagctaatccgccaggcagctctgcagcagaccaaggagatggacctcagcgtggtgcggctcatgtttacagcttttcttccggatagcactggcagcttcacaaggcgcctggaacccgtggtatcagacgccatctatgacagtaaagcccccaatgcatccaacttgaaaattgtaagaatggacaggacagctggatgtgtgactggaggagaggaaatttatcttctctgtgacaaagttcagaaagatgacatccagattcgattttacgaagaagaggaaaatggtggagtctgggaaggatttggagatttttcccctacagatgttcatagacaatttgccatcgtcttcaaaaccccaaagtataaagatgttaatattacaaaaccagcttctgtgtttgtccagcttcggaggaaatctgacttggaaactagtgaaccaaaacctttcctttactatcctgaaataaaagataaagaagaagtgcagaggaaacgacaaaagctcatgcccaatttttcggatagtttcggcggtggtagtggtgccggagctggaggcggaggcatgtttggtagtggcggtggaggagggggcactggaagtacaggtccagggtatagcttcccacactatggatttcctacttatggagggattaccttccatcctggaactactaaatctaatgctgggatgaaacatggaactatggacagtgaatctaaaaaggaccctgaaggttgtgacaaaagtgatgacagagacactgtaaacctctttggaaaagtcactgaaaccacagagcaggatcaggagcccagcaaggccaccgatgggaatggtgaggtcgctctaacgtatgcaacagaaaccaaagaagagagtgctggggttcaggataacctctttctagagaaggctatgcagcttgcaaagaggcatgccaatgcccttttcgactatgcagtgacaggagacgtgaagatgttgctggctgtccagcgccatctcactgctgtgcaggatgagaatggggacagtgtcttacacctagcaatcatccaccttcattctcaacttgtgagggatctactagaagtcacatctggtttgatttctgatgacattatcaacatgagaaatgacctgtaccagacacccttgcacttggcagtgatcactaagcaggaaaatgtggtggaggatttgctgagggccggggctgacctgagccttctggaccgcttcggtaactctgttttgcacctagctgccaaagaaggaaatgataaagttctcagtatcttactcaagcacaaaaaggcagcactacttcttgaccaccccaacggggacggtctgaatgccattcatctagccatgatgagcaatagcctgccatgtctgctgctgctggtggccgctggggccaacgtcaatgctcaggagcaaaagtctggacgcacagccctgcacctggctgtggagcacgacaacatctcattggcaggctgcctgctcctggagggtgatgcccatgtggacagtactacctacgatggaactacacccctgcatatagcagctgggagagggtccaccaggctggccgctcttctcaaagcagcaggagcagatcccctggtggagaactttgagcctctctatgacctggatgactcttgggaaaatgcaggagaggatgaaggagttgtacctggaaccacacctctagatatggccaccagctggcaggtatttgacatattaaatgggaaaccatatgagccagagtttacatctgatgatttactggcacaaggagacatgaaacagctggctgaagatgtgaagctgcagctctataagttgctagaaattcctgatccagacaaaaactgggctactttggcacagaaattaggtctggggatacttaataatgccttccggctgagtcctgctccttccaaaacacttatggacaactatgaggtctctggggggacggtcagagagctggtggaggccctgagacaaatgggctacaccgaagcagttgaagtgatccaggcagcctccagcccagtgaagaccacctcgcaggcccactcactgcctctctcacctgcatccacaaggcagcaaatagatgagctccgagacagcgacagtgtctgcgacagcggcgtggagacgtccttccacaggctcagcttcaccgagtctctgaccagtggtggctcactgctaactctcaacaaaatgccccatgattatgggcaggaaggacctctagaaggcaaaatttagcctgctgacaatttcccacaccatgtaaaccaaagccctgaaattccactgcattgtccacaagaagaaagctgaagcgcatccaaaggtgctcagagagctggcctgccagaatcattctcgatttaacgcaaggccttttcaacttggcttcctttcttggttcataaatgaattttagtttggttcacttacagatagtatctagcaatcatagcactggctgagcggatgcatctggggatgaggctgcttactgagctttgccggccgctgctggatcacagctgctttctgttgtcattgttgtccctctgctacgttcctgttgtcattaaagtgtcactggccccacctggcattccttctgaccacccacagcatcgttttgcattcaaattaagcgttaagaaaagggatattttaaaatgaaagtcacttgatgtgcaatttaaaaaaaaggcgtattactttttctaatgtggttatttctcggcttt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]