GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-09-18 11:53:57, GGRNA.v2 : RefSeq release 231 (Jul, 2025)

LOCUS       XM_016471800            1704 bp    mRNA    linear   VRT 03-JUN-2025
DEFINITION  PREDICTED: Sinocyclocheilus anshuiensis uncharacterized
            LOC107677019 (LOC107677019), mRNA.
ACCESSION   XM_016471800
VERSION     XM_016471800.1
DBLINK      BioProject: PRJNA319338
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Sinocyclocheilus anshuiensis
  ORGANISM  Sinocyclocheilus anshuiensis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Cyprinidae; Cyprininae; Sinocyclocheilus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_015557087.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_001515605.1-RS_2025_05
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.4
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 05/30/2025
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 3% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..1704
                     /organism="Sinocyclocheilus anshuiensis"
                     /mol_type="mRNA"
                     /isolate="Anshui"
                     /db_xref="taxon:1608454"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="muscle"
                     /dev_stage="adult"
                     /geo_loc_name="China: Lingyun, Guangxi"
                     /collection_date="2012-08-20"
                     /note="cave-restricted"
     gene            1..1704
                     /gene="LOC107677019"
                     /note="uncharacterized LOC107677019; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 6
                     Proteins, and 84% coverage of the annotated genomic
                     feature by RNAseq alignments"
                     /db_xref="GeneID:107677019"
     CDS             1..1704
                     /gene="LOC107677019"
                     /codon_start=1
                     /product="uncharacterized protein LOC107677019"
                     /protein_id="XP_016327286.1"
                     /db_xref="GeneID:107677019"
                     /translation="
MMRSFQHSYFQLLYLLMAALLECKGKQRPCKQVHQLNISHLHGDSMSISCQSTTHPLDSLTVKLHSINPVKDILVYPDISPASEHQRWSVRKDDGNVTLDLKDIRLSDGGLYDCQVYKDQDCLHATQFYLSIIQCKTLNSVHATLNSQVLLPCSEHPLQNRTERVTWKVINGHQLTDITQYRAPNKPSSSTENQKELYFLSGCLISLFYSLLPETERPCKQVHQLNISHLHGDSMSISCQSTTHPLDSLTVKLHSINPVKDILVYPDISPASEHQRWSVRKDDGNVTLDLKDIRLSDGGLYDCQVYKDQDCLHATQFYLSIIQCKTLNSVHATLNSQVLLPCSEHPLQNRTERVTWKVINGHQLTDITQYRAPNKPSSSTEKPPNPLFERARQLKNGSLLIRKAVATDELWYHCRVNEKTCYEMRLVMKAHNTSRSTKVLETLSTTLVTTASADSLAGLAENNSDGSETVTTNLTVVVMVTTVVSLCVLISLTICVILYFKKQRRKTNSQTQLNSRFSVYYSRVAEGFDVPLYSLVEQNTGTMITFGAAQSEAPACKADNMYEKLTL"
     misc_feature    127..378
                     /gene="LOC107677019"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:214653"
     misc_feature    136..150
                     /gene="LOC107677019"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    181..201
                     /gene="LOC107677019"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    289..303
                     /gene="LOC107677019"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    331..348
                     /gene="LOC107677019"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    694..945
                     /gene="LOC107677019"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:214653"
     misc_feature    703..717
                     /gene="LOC107677019"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    748..768
                     /gene="LOC107677019"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    856..870
                     /gene="LOC107677019"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    898..915
                     /gene="LOC107677019"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
ORIGIN      
atgatgaggagttttcagcattcttatttccaactcctgtatcttctaatggcagcgttattagaatgcaaaggtaagcagagaccctgcaagcaggttcatcagttgaacataagccatttacatggtgacagcatgtctatttcttgccaatcaacaacccacccgctggattctctaacagtcaaactacacagtatcaacccggttaaagacattctggtgtatccagacatctctccagcatcagagcaccagagatggtctgtgaggaaagatgatggaaatgttacacttgatctgaaagacatcagattatccgatggtggtctttatgactgtcaggtctacaaggatcaggactgccttcatgcaacacaattttacctgagtattatacagtgtaaaactttgaactctgtccatgcaacgctaaactcgcaagtgttactgccatgctctgaacatcctctacaaaacagaactgaacgagtcacttggaaagtcattaatggtcaccaattaacagatataacccagtatcgcgctccaaacaagccctcaagcagcacagagaatcagaaagagctttattttctctcaggatgtctcatttctcttttttattcccttttacccgaaacagagagaccctgcaagcaggttcatcagttgaacataagccatttacatggtgacagcatgtctatttcttgccaatcaacaacccacccgctggattctctaacagtcaaactacacagtatcaacccggttaaagacattctggtgtatccagacatctctccagcatcagagcaccagagatggtctgtgaggaaagatgatggaaatgttacacttgatctgaaagacatcagattatccgatggtggtctttatgactgtcaggtctacaaggatcaggactgccttcatgcaacacaattttacctgagtattatacagtgtaaaactttgaactctgtccatgcaacgctaaactcgcaagtgttactgccatgctctgaacatcctctacaaaacagaactgaacgagtcacttggaaagtcattaatggtcaccaattaacagatataacccagtatcgcgctccaaacaagccctcaagcagcacagagaaacccccgaaccccctgtttgagagagcgagacaactaaagaacggatctttgcttataagaaaagcggtcgccactgatgaattgtggtatcattgcagagtgaatgaaaaaacctgctatgagatgaggctggtgatgaaagctcataatacatctcgttccacaaaggtattagaaacactttccacaacattggtaaccacagcctctgctgacagtcttgctggcctggctgaaaataacagtgatgggagtgaaacagtgacaactaatctgacagtagtagtgatggtgaccacagtagtgtctctgtgtgtcctcatatcactaaccatctgcgtcattctttatttcaaaaaacaaaggcgcaaaaccaacagccaaacacagttaaacagtcggttctctgtgtattactcccgtgttgcagaagggtttgatgtcccattgtattctttagttgaacaaaacacaggaacaatgatcacctttggtgctgcacaatcagaagctccggcatgtaaagcagataacatgtatgaaaagttaacattgtga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]