2025-09-18 11:53:57, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS XM_016471800 1704 bp mRNA linear VRT 03-JUN-2025 DEFINITION PREDICTED: Sinocyclocheilus anshuiensis uncharacterized LOC107677019 (LOC107677019), mRNA. ACCESSION XM_016471800 VERSION XM_016471800.1 DBLINK BioProject: PRJNA319338 KEYWORDS RefSeq; includes ab initio. SOURCE Sinocyclocheilus anshuiensis ORGANISM Sinocyclocheilus anshuiensis Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Cyprinidae; Cyprininae; Sinocyclocheilus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_015557087.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Updated annotation Annotation Name :: GCF_001515605.1-RS_2025_05 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.4 Annotation Method :: Best-placed RefSeq; Gnomon; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 05/30/2025 ##Genome-Annotation-Data-END## ##RefSeq-Attributes-START## ab initio :: 3% of CDS bases ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..1704 /organism="Sinocyclocheilus anshuiensis" /mol_type="mRNA" /isolate="Anshui" /db_xref="taxon:1608454" /chromosome="Unknown" /sex="female" /tissue_type="muscle" /dev_stage="adult" /geo_loc_name="China: Lingyun, Guangxi" /collection_date="2012-08-20" /note="cave-restricted" gene 1..1704 /gene="LOC107677019" /note="uncharacterized LOC107677019; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 6 Proteins, and 84% coverage of the annotated genomic feature by RNAseq alignments" /db_xref="GeneID:107677019" CDS 1..1704 /gene="LOC107677019" /codon_start=1 /product="uncharacterized protein LOC107677019" /protein_id="XP_016327286.1" /db_xref="GeneID:107677019" /translation="
MMRSFQHSYFQLLYLLMAALLECKGKQRPCKQVHQLNISHLHGDSMSISCQSTTHPLDSLTVKLHSINPVKDILVYPDISPASEHQRWSVRKDDGNVTLDLKDIRLSDGGLYDCQVYKDQDCLHATQFYLSIIQCKTLNSVHATLNSQVLLPCSEHPLQNRTERVTWKVINGHQLTDITQYRAPNKPSSSTENQKELYFLSGCLISLFYSLLPETERPCKQVHQLNISHLHGDSMSISCQSTTHPLDSLTVKLHSINPVKDILVYPDISPASEHQRWSVRKDDGNVTLDLKDIRLSDGGLYDCQVYKDQDCLHATQFYLSIIQCKTLNSVHATLNSQVLLPCSEHPLQNRTERVTWKVINGHQLTDITQYRAPNKPSSSTEKPPNPLFERARQLKNGSLLIRKAVATDELWYHCRVNEKTCYEMRLVMKAHNTSRSTKVLETLSTTLVTTASADSLAGLAENNSDGSETVTTNLTVVVMVTTVVSLCVLISLTICVILYFKKQRRKTNSQTQLNSRFSVYYSRVAEGFDVPLYSLVEQNTGTMITFGAAQSEAPACKADNMYEKLTL"
misc_feature 127..378 /gene="LOC107677019" /note="Immunoglobulin like; Region: IG_like; smart00410" /db_xref="CDD:214653" misc_feature 136..150 /gene="LOC107677019" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 181..201 /gene="LOC107677019" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 289..303 /gene="LOC107677019" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 331..348 /gene="LOC107677019" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 694..945 /gene="LOC107677019" /note="Immunoglobulin like; Region: IG_like; smart00410" /db_xref="CDD:214653" misc_feature 703..717 /gene="LOC107677019" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 748..768 /gene="LOC107677019" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 856..870 /gene="LOC107677019" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 898..915 /gene="LOC107677019" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" ORIGIN
atgatgaggagttttcagcattcttatttccaactcctgtatcttctaatggcagcgttattagaatgcaaaggtaagcagagaccctgcaagcaggttcatcagttgaacataagccatttacatggtgacagcatgtctatttcttgccaatcaacaacccacccgctggattctctaacagtcaaactacacagtatcaacccggttaaagacattctggtgtatccagacatctctccagcatcagagcaccagagatggtctgtgaggaaagatgatggaaatgttacacttgatctgaaagacatcagattatccgatggtggtctttatgactgtcaggtctacaaggatcaggactgccttcatgcaacacaattttacctgagtattatacagtgtaaaactttgaactctgtccatgcaacgctaaactcgcaagtgttactgccatgctctgaacatcctctacaaaacagaactgaacgagtcacttggaaagtcattaatggtcaccaattaacagatataacccagtatcgcgctccaaacaagccctcaagcagcacagagaatcagaaagagctttattttctctcaggatgtctcatttctcttttttattcccttttacccgaaacagagagaccctgcaagcaggttcatcagttgaacataagccatttacatggtgacagcatgtctatttcttgccaatcaacaacccacccgctggattctctaacagtcaaactacacagtatcaacccggttaaagacattctggtgtatccagacatctctccagcatcagagcaccagagatggtctgtgaggaaagatgatggaaatgttacacttgatctgaaagacatcagattatccgatggtggtctttatgactgtcaggtctacaaggatcaggactgccttcatgcaacacaattttacctgagtattatacagtgtaaaactttgaactctgtccatgcaacgctaaactcgcaagtgttactgccatgctctgaacatcctctacaaaacagaactgaacgagtcacttggaaagtcattaatggtcaccaattaacagatataacccagtatcgcgctccaaacaagccctcaagcagcacagagaaacccccgaaccccctgtttgagagagcgagacaactaaagaacggatctttgcttataagaaaagcggtcgccactgatgaattgtggtatcattgcagagtgaatgaaaaaacctgctatgagatgaggctggtgatgaaagctcataatacatctcgttccacaaaggtattagaaacactttccacaacattggtaaccacagcctctgctgacagtcttgctggcctggctgaaaataacagtgatgggagtgaaacagtgacaactaatctgacagtagtagtgatggtgaccacagtagtgtctctgtgtgtcctcatatcactaaccatctgcgtcattctttatttcaaaaaacaaaggcgcaaaaccaacagccaaacacagttaaacagtcggttctctgtgtattactcccgtgttgcagaagggtttgatgtcccattgtattctttagttgaacaaaacacaggaacaatgatcacctttggtgctgcacaatcagaagctccggcatgtaaagcagataacatgtatgaaaagttaacattgtga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]