GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-09-18 11:52:44, GGRNA.v2 : RefSeq release 231 (Jul, 2025)

LOCUS       XM_016267859            1969 bp    mRNA    linear   VRT 04-MAR-2025
DEFINITION  PREDICTED: Sinocyclocheilus grahami uncharacterized protein
            (LOC107582125), mRNA.
ACCESSION   XM_016267859
VERSION     XM_016267859.1
DBLINK      BioProject: PRJNA316320
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Sinocyclocheilus grahami
  ORGANISM  Sinocyclocheilus grahami
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Cyprinidae; Cyprininae; Sinocyclocheilus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_015505219.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_001515645.1-RS_2025_02
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 02/27/2025
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 6% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..1969
                     /organism="Sinocyclocheilus grahami"
                     /mol_type="mRNA"
                     /isolate="Dianchi"
                     /db_xref="taxon:75366"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="muscle"
                     /dev_stage="adult"
                     /geo_loc_name="China: Lake Dianchi, Yunnan"
                     /collection_date="2012-08-15"
                     /note="surface-dwelling"
     gene            1..1969
                     /gene="LOC107582125"
                     /note="uncharacterized LOC107582125; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 3
                     Proteins, and 92% coverage of the annotated genomic
                     feature by RNAseq alignments"
                     /db_xref="GeneID:107582125"
     CDS             11..1969
                     /gene="LOC107582125"
                     /codon_start=1
                     /product="uncharacterized protein"
                     /protein_id="XP_016123345.1"
                     /db_xref="GeneID:107582125"
                     /translation="
MMRSFQSPYFQLLCLLIAALLECKERPCKQVLQLNISHLHGDCMSISCQSTTHLLDSLTVKLSSINPVKDILMYPDISPASEHQRWSVRKDDGNFTLDLKDIRLSDGGLYDCQVYKDQDCLHSTQFYLSIIQCKILNSVHATLNSQVLLPCSEHPLQNRTEPVTWKVINGHQLTDITQYRAPNKPSSGTEKPPNPLFERARLLKNGSLLIRKAVDTDELWYHCRVNEKTCYEMRLVMKVQLSCCEHLYMMRSFQSPYFQLLCLLIAALLECKERPCKQVLQLNISHLHGDCMSISCQSTTHLLDSLTVKLSSINPVKDILMYPDISPASEHQRWSVRKDDGNFTLDLKDIRLSDGGLYDCQVYKDQDCLHSTQFYLSIIQCKILNSVHATLNSQVLLPCSEHPLQNRTEPVTWKVINGHQLTDITQYRAPNKPSSGTEKPPNPLFERARLLKNGSLLIRKAVDTDELWYHCRVNEKTCYEMRLVMKAHNTSRSTKVLETLSTTLVTTASADSLAGLAENNSDGSETVTTNLTVVVMMTTVVSLCVLISLTICVILYFKKQRRKTNSQTQLNSRISVYYSHVAEGFDVPLYSLVEQNTGSMITFGAAQSEAPACKADNIETCEEEEEEEEEGSVWQNRSARGESCTEAIHYSA"
     misc_feature    113..361
                     /gene="LOC107582125"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    140..154
                     /gene="LOC107582125"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    185..205
                     /gene="LOC107582125"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    293..307
                     /gene="LOC107582125"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    335..352
                     /gene="LOC107582125"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    <575..685
                     /gene="LOC107582125"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    626..640
                     /gene="LOC107582125"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    668..685
                     /gene="LOC107582125"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    857..1105
                     /gene="LOC107582125"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    884..898
                     /gene="LOC107582125"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    929..949
                     /gene="LOC107582125"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    1037..1051
                     /gene="LOC107582125"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    1079..1096
                     /gene="LOC107582125"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    <1319..1429
                     /gene="LOC107582125"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    1370..1384
                     /gene="LOC107582125"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    1412..1429
                     /gene="LOC107582125"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
ORIGIN      
gcatctgtatatgatgaggagttttcagtctccatatttccaactcctgtgtcttctaatagcagcgttattagaatgcaaagagagaccctgcaagcaggttcttcagttgaacataagccatttacatggtgactgtatgtctatttcttgccaatcaacaacccacctgctggattctctaacagtcaaactaagcagtatcaacccggttaaagacatactgatgtatccagatatctctccagcatcagagcaccagagatggtctgtgaggaaagatgatggaaattttacacttgatctgaaagacatcagattatccgatggtggcctttatgactgtcaggtctacaaggatcaggactgccttcattcaacacaattttacctgagtattatacagtgtaaaattttgaactctgtccatgcaacgttaaactcgcaagtgttactgccatgctctgaacatcctctacaaaacagaactgaaccagtcacttggaaagtcattaatggtcaccaattaacagatataacccagtatcgcgctccaaacaagccctcaagcggcacagagaaacccccgaaccccctgtttgagagagcgagactactgaagaacggatctttgcttataagaaaagcagtcgacactgatgaattgtggtatcattgcagagtgaatgaaaaaacctgctatgagatgaggctggtgatgaaagttcagctgtcctgctgtgagcatctgtatatgatgaggagttttcagtctccatatttccaactcctgtgtcttctaatagcagcgttattagaatgcaaagagagaccctgcaagcaggttcttcagttgaacataagccatttacatggtgactgtatgtctatttcttgccaatcaacaacccacctgctggattctctaacagtcaaactaagcagtatcaacccggttaaagacatactgatgtatccagatatctctccagcatcagagcaccagagatggtctgtgaggaaagatgatggaaattttacacttgatctgaaagacatcagattatccgatggtggcctttatgactgtcaggtctacaaggatcaggactgccttcattcaacacaattttacctgagtattatacagtgtaaaattttgaactctgtccatgcaacgttaaactcgcaagtgttactgccatgctctgaacatcctctacaaaacagaactgaaccagtcacttggaaagtcattaatggtcaccaattaacagatataacccagtatcgcgctccaaacaagccctcaagcggcacagagaaacccccgaaccccctgtttgagagagcgagactactgaagaacggatctttgcttataagaaaagcagtcgacactgatgaattgtggtatcattgcagagtgaatgaaaaaacctgctatgagatgaggctggtgatgaaagctcataatacatctcgttccacaaaggtattagaaacactttccacaacattggtaaccacagcctctgctgacagtcttgctggcctggctgaaaataacagtgatgggagtgaaacagtgacaactaatctgacagtagtagtgatgatgaccacagtagtgtctctgtgtgtcctcatatcactgaccatctgtgtcattctttatttcaaaaaacaaaggcgcaaaaccaacagccaaacacagttaaacagtcggatctctgtgtattactcccatgttgcagaagggtttgatgtcccattgtattctttagttgaacaaaacacaggatcaatgatcacctttggtgctgcacaatcagaagctccggcatgtaaagcagataacattgaaacctgcgaggaggaggaggaggaggaggaggaggggagtgtctggcagaaccgttcagctcgcggtgagagctgcaccgaggctattcattattcagcgtga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]