2024-04-23 23:23:05, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_016205695 3321 bp mRNA linear MAM 11-APR-2016 DEFINITION PREDICTED: Miniopterus natalensis NRDE-2, necessary for RNA interference, domain containing (NRDE2), transcript variant X4, mRNA. ACCESSION XM_016205695 VERSION XM_016205695.1 DBLINK BioProject: PRJNA317472 KEYWORDS RefSeq. SOURCE Miniopterus natalensis ORGANISM Miniopterus natalensis Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Chiroptera; Microchiroptera; Vespertilionidae; Miniopterinae; Miniopterus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_015504386.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Miniopterus natalensis Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 7.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3321 /organism="Miniopterus natalensis" /mol_type="mRNA" /isolate="MN2012-01" /db_xref="taxon:291302" /chromosome="Unknown" /sex="male" /tissue_type="skeletal muscle" /dev_stage="adult" /country="South Africa" /collection_date="Oct-2012" gene 1..3321 /gene="NRDE2" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 2 samples with support for all annotated introns" /db_xref="GeneID:107531582" CDS 57..3233 /gene="NRDE2" /codon_start=1 /product="protein NRDE2 homolog isoform X4" /protein_id="XP_016061181.1" /db_xref="GeneID:107531582" /translation="
MALFPAFAGVSEAPDSGSARKELDWLSNPSFCVETVTTLSQQTEEATALISEGPPLTSRSPLKSETSDAGDTNRKLRQASRRKKEKKRKRKRQHRSRDRRRRGRSGSSASESGTDPGKDRAPRGFRDADKESEKPNQENNAASAAGRHCVWLEDIQALTGETFRTDKKPDPANWEYKSLYRGDIARYKRKGDSCLGINPKKQCISWEGASTEKRRSHKHVERYFTRKNVGLMSTDGVAISSHTEPLSSEPVSFIPVKGLDDVAPVTTWLNPLGIYDQSTTLWLQGQGPSEQESKQPDSQPDRENALLKAKVEEFNRRVRENPQDIQLWMAFVAFQDEVMRSPGLYAIEEGEQKRKRSLKLILEKKLAILERAIESNQSSVDLKLAKLKLCTEFWEPSTLLREWQKLIFLHPNNTALWQKYLLFCQSQFSTFSVSKIHSLYGKCLSTLSAVKDGSILSHPELPGTEVAMFALFLQQCHFLRQAGHLEKAVSLFQAMVDFTFFKPDSVKDLPTRGQVEFFEPFWDSGEPRAGERGARGWRAWMHQQERGGWVVINPDDDDDEPEDDDQEIKDKTLPRWQIWLAAERSRDQRHWRPWRPDKTKKQTEEDCEDPERQVLFDDIGQSLIRLSSQDLQFQLIAAFLQFLGVPSGFSPPASCLYLAMDENSIFDNGLYDEQPLTFLNLSFSGVSCVGRTDQLGCRRWTRGHSREGEEFICNIFHLVMPLFSGRERSQLCSSWLRYEIAKVIWCLHTKNKKRLKSRGKNCKKLAKNLLKEPENRNNFCLWKQYAHLEWLLGNTEDARKVFDTALSTAGSGELKDPEVCELSLLYAELELELAPDLRVATEARAVHILTRLAENSPYGPYTGQVLAVHILKARKAYEHALQDCLGESCIPDPASLNRLVSVVKCFMLFQYLTIGIDAAVQIYEHVFPKLKGSVTSEGPSLEDSASPQSARNILEAITLMHTSLLRFHMKVSVYPLAPLRQALSEALKLYPGNQVLWRSYVQIQNKSHSASKSRRFFDAITRSAKPLEPWLFAIEAEKMRKRLVETVQRWQRGVRDYS"
misc_feature 540..827 /gene="NRDE2" /note="MTR4-interacting domain (MID) found in nuclear exosome regulator NRDE2 and similar proteins; Region: NRDE2_MID; cd22200" /db_xref="CDD:412062" misc_feature order(540..566,573..578,588..593,597..599,603..647, 654..662,666..674,696..704,714..719,723..728,735..755, 780..791,801..827) /gene="NRDE2" /note="MTR4 binding site [polypeptide binding]; other site" /db_xref="CDD:412062" misc_feature 993..1988 /gene="NRDE2" /note="necessary for RNA interference; Region: NRDE-2; pfam08424" /db_xref="CDD:429988" ORIGIN
acgtccgctcgccggcgccattcccgtagccgggaacggcggtgcggcctgtgactatggcgctgttcccggcctttgcgggcgttagtgaggctcccgatagcgggagcgccaggaaagaattagattggctgagcaacccaagcttttgtgttgaaactgtaacaactctgagccaacaaactgaagaggctacagctcttatttctgaagggccaccactaacaagcaggagccctctgaaatcagagacttcagatgccggggacacaaacagaaagctcaggcaagcgagcaggaggaagaaagagaagaagaggaaaaggaagcgccagcaccgcagcagagacaggaggaggcgagggcggtcagggagcagtgcgtccgagtcaggcactgatcctggaaaggacagagctcccagaggcttcagagatgctgacaaagagtcggagaaaccgaaccaagaaaataatgctgcttctgctgctggacgtcactgtgtttggcttgaggacattcaggctctgactggagaaaccttcagaacagataagaaaccagatcctgcaaactgggagtacaagtccctctaccgaggagatatagcaagatacaagaggaaaggagactcctgcctcggcattaaccctaagaagcagtgtatatcctgggagggggcctccacggaaaagaggcgttcgcacaagcatgtggagcgctatttcacgaggaagaacgtgggactgatgagcacggacggagttgccattagcagtcacactgaacccctctcatctgagccagtctcttttatcccagtgaagggcttggacgatgtggctcctgttacaacctggttgaatcctctgggcatttatgatcaatccaccacactgtggttacagggacagggcccttcagagcaggaatcaaagcagccagactcacagccagaccgagagaacgcccttctcaaggccaaggtggaggagtttaacaggagggtgcgggagaatccccaggatattcagctgtggatggcgtttgttgcttttcaggacgaggtcatgaggagtcctggcctatatgccatcgaggaaggagagcagaagcggaagaggtcgctgaagctcatcctagagaagaagctggccatcctggagcgggccatcgaaagcaaccagagcagtgtggacctgaagctcgccaagctgaagctctgcaccgagttctgggagccctccacgctgctcagagagtggcagaaactgatattcttacatcccaacaatacagccctttggcaaaaataccttttattttgccagagccagttcagcaccttttcagtatcaaaaatccacagtctttatggaaagtgcttgagtactttgtctgcagtgaaggatggcagcatcttatctcaccctgagctgcctggcactgaagtggccatgttcgcgctcttcctgcagcagtgccacttcctgcgccaggctggtcacttggagaaggccgtctccttgttccaggccatggttgacttcaccttcttcaaaccagacagtgtgaaagatctgcccaccaggggacaggtggaattctttgagcccttctgggacagtggagagccccgggctggggagaggggcgcccgaggctggagggcgtggatgcaccagcaggagaggggaggctgggtggtcatcaacccagatgatgatgatgatgaaccggaagatgatgaccaggaaattaaagataagactctgcccaggtggcagatctggctggctgctgagcggtcccgagaccagaggcactggcggccatggcgccctgataagaccaagaagcaaactgaggaagattgtgaggatccagagagacaggtgctgtttgatgatattggacagtctctaatccgactttccagccaagatcttcaattccagctgattgcggcctttctgcagtttttgggtgttccttctggcttcagccctccagcctcctgcctctatctggccatggatgagaacagcatctttgataatggcctttatgacgaacagccattgacttttctcaacctttccttttccggcgtcagctgtgttggtcgcacagaccagttgggctgccggcgctggaccaggggtcacagccgagagggcgaggagttcatctgcaacatcttccacctggtgatgcctttgttttcaggcagggagaggtctcagctctgttcctcctggttgcggtacgagatcgcaaaggtcatttggtgtctgcacactaaaaacaagaagaggctaaagtcacgagggaagaactgcaaaaaactagccaagaatctccttaaggagccagaaaaccgcaacaatttttgcctctggaagcagtatgcacatctggagtggttgctcggcaacacagaggatgccagaaaagtttttgatacagcactcagcacggcagggagcggagagctgaaggaccctgaggtctgtgagctcagtctgctctatgctgagctggagctggagctggcaccggacctcagagtggccaccgaggcccgagctgttcacatattaactaggcttgctgagaacagtccctatgggccctacaccgggcaggtcctggcagttcacattttgaaagctcggaaggcttatgagcatgcactgcaggactgtttgggggagagctgtattcctgatccagcttcccttaaccgcctagttagcgtggttaaatgctttatgctcttccagtatttgaccatagggattgatgctgctgtgcagatatatgagcacgtatttccaaaactgaagggctctgttacctcagaaggcccaagcctggaagacagtgccagcccacagagtgcaaggaacattctcgaggctatcacactgatgcacacgagtctgctcaggttccacatgaaagtcagtgtttaccctctggctccgctgcgacaggcgctttcagaggctttgaagttgtatccgggcaaccaggttctttggaggtcctatgtacagattcaaaacaagtcccacagcgccagcaagagcaggagattctttgatgcaattaccaggtctgcgaaacccttggagccatggttgtttgccattgaagctgagaaaatgaggaaaagactggtggaaactgtccagagatggcagagaggtgtacgcgactattcctgagactggcttgacgcaccggatcagagccctgtttgaaaatgcgatccgcagtgaccacggcagccagtgtcctttactgtggaggctg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]