2024-04-20 01:14:38, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_015934897 1201 bp mRNA linear INV 22-MAY-2018 DEFINITION PREDICTED: Tetranychus urticae protein argonaute-2-like (LOC107367184), partial mRNA. ACCESSION XM_015934897 VERSION XM_015934897.1 DBLINK BioProject: PRJNA315122 KEYWORDS RefSeq; includes ab initio. SOURCE Tetranychus urticae (two-spotted spider mite) ORGANISM Tetranychus urticae Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Chelicerata; Arachnida; Acari; Acariformes; Trombidiformes; Prostigmata; Eleutherengona; Raphignathae; Tetranychoidea; Tetranychidae; Tetranychus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_015449719.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Tetranychus urticae Annotation Release 101 Annotation Version :: 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## ##RefSeq-Attributes-START## ab initio :: 100% of CDS bases ##RefSeq-Attributes-END## COMPLETENESS: incomplete on the 3' end. FEATURES Location/Qualifiers source 1..1201 /organism="Tetranychus urticae" /mol_type="mRNA" /db_xref="taxon:32264" /chromosome="Unknown" /note="scaffold_479" gene 1..>1201 /gene="LOC107367184" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 5 Proteins" /db_xref="GeneID:107367184" CDS 1..>1201 /gene="LOC107367184" /codon_start=1 /product="protein argonaute-2-like" /protein_id="XP_015790383.1" /db_xref="GeneID:107367184" /translation="
MSKRPYKPRRGRGRGHNVNSVARIYDGNSENRVGPELLTPLGNFDCSGQDGDNKRSRDKVDEEFQIGLADPEFVKRRGYLSENFGRKIKLMTNHFSFQYSPDVQIYHYDFSWLCYGKDGEEPKEQKLNSDNCYKLFDAVMAKYPEHFTSTSSVGYDGAANVYLPYELESESSNLAVPDVELEDGVKKNFIVTFKGGKVISLASVKEYYAGSKMDDTKRKSLQEVIHIILKFPSRYNMKALGRLAMFPINAERYYLSNWMELALGHRKSLRFSEIGLTLVVDRASAAFLKSGNGLDFVKSIIDRQGGSLSTFKPSPAQIEALRRAFAGVKISTVHLGYTKKYVVKDIAEIAANKDTFKLKEGEIDQVTVADFYKMKHKIVLEYPNLPCLITSNNSKIPIEV"
misc_feature 934..>1201 /gene="LOC107367184" /note="PAZ domain; Region: PAZ; pfam02170" /db_xref="CDD:426635" misc_feature order(1021..1023,1066..1068,1102..1104,1114..1116, 1168..1170,1186..1188) /gene="LOC107367184" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" ORIGIN
atgagtaagcgaccttataaacctagaagagggagaggtcgtggccacaacgttaatagtgttgcacggatttatgatggaaatagtgaaaatcgcgttggacctgaactgttaacaccgttgggaaatttcgattgtagcggccaagatggtgataataagcgaagtcgtgataaagttgatgaagagtttcaaattggattggcagaccctgaatttgtgaaaaggagaggatatttatctgaaaattttggtcgcaaaatcaaactaatgacgaatcatttttcgttccaatattccccagatgttcaaatttatcattatgacttttcatggttatgttacggtaaagatggtgaagaaccaaaagaacaaaaactgaacagtgataattgttataagctattcgacgcagttatggcaaaatacccagagcatttcacttcgacgtcttcagtaggctatgatggtgcggcaaacgtgtatttaccatatgagcttgagtcggaatcaagcaatcttgctgtcccggacgttgaattggaagatggagttaaaaaaaatttcatcgtgacttttaaaggtggtaaagtcatctctttggcatcagttaaggaatattatgctggctcgaagatggatgatactaaacgcaaatctctccaagaagtcattcacattattttgaagttcccctcaagatacaatatgaaagctttaggtcgtctcgccatgtttccgatcaatgcagagagatattatttgtcaaactggatggaattggctttgggtcatagaaaatctcttcgattttcagaaattggtttgacattggtagtggatagagcatctgctgcattcctcaagtctggtaatggtttagactttgtaaaatctataattgatcgccaaggaggatctctgtctacttttaaacccagtccagcgcaaatagaagccctcagaagggcgtttgctggtgttaaaatttcgactgttcatctcgggtacacaaaaaaatatgttgtgaaagatattgctgaaatcgcagctaataaagacacattcaagttaaaggaaggtgaaattgatcaggttactgtggccgatttttataaaatgaaacataagatagtcttggaataccctaatctaccttgtttgattacaagtaacaactccaaaatcccaatagaagtct
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]