LOCUS       XM_015934897            1201 bp    mRNA    linear   INV 22-MAY-2018
DEFINITION  PREDICTED: Tetranychus urticae protein argonaute-2-like
            (LOC107367184), partial mRNA.
ACCESSION   XM_015934897
VERSION     XM_015934897.1
DBLINK      BioProject: PRJNA315122
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Tetranychus urticae (two-spotted spider mite)
  ORGANISM  Tetranychus urticae
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Chelicerata; Arachnida;
            Acari; Acariformes; Trombidiformes; Prostigmata; Eleutherengona;
            Raphignathae; Tetranychoidea; Tetranychidae; Tetranychus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_015449719.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Tetranychus urticae Annotation
                                           Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 100% of CDS bases
            ##RefSeq-Attributes-END##
            COMPLETENESS: incomplete on the 3' end.
FEATURES             Location/Qualifiers
     source          1..1201
                     /organism="Tetranychus urticae"
                     /mol_type="mRNA"
                     /db_xref="taxon:32264"
                     /chromosome="Unknown"
                     /note="scaffold_479"
     gene            1..>1201
                     /gene="LOC107367184"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 5 Proteins"
                     /db_xref="GeneID:107367184"
     CDS             1..>1201
                     /gene="LOC107367184"
                     /codon_start=1
                     /product="protein argonaute-2-like"
                     /protein_id="XP_015790383.1"
                     /db_xref="GeneID:107367184"
                     /translation="

MSKRPYKPRRGRGRGHNVNSVARIYDGNSENRVGPELLTPLGNFDCSGQDGDNKRSRDKVDEEFQIGLADPEFVKRRGYLSENFGRKIKLMTNHFSFQYSPDVQIYHYDFSWLCYGKDGEEPKEQKLNSDNCYKLFDAVMAKYPEHFTSTSSVGYDGAANVYLPYELESESSNLAVPDVELEDGVKKNFIVTFKGGKVISLASVKEYYAGSKMDDTKRKSLQEVIHIILKFPSRYNMKALGRLAMFPINAERYYLSNWMELALGHRKSLRFSEIGLTLVVDRASAAFLKSGNGLDFVKSIIDRQGGSLSTFKPSPAQIEALRRAFAGVKISTVHLGYTKKYVVKDIAEIAANKDTFKLKEGEIDQVTVADFYKMKHKIVLEYPNLPCLITSNNSKIPIEV"

     misc_feature    934..>1201
                     /gene="LOC107367184"
                     /note="PAZ domain; Region: PAZ; pfam02170"
                     /db_xref="CDD:426635"
     misc_feature    order(1021..1023,1066..1068,1102..1104,1114..1116,
                     1168..1170,1186..1188)
                     /gene="LOC107367184"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
ORIGIN      

atgagtaagcgaccttataaacctagaagagggagaggtcgtggccacaacgttaatagtgttgcacggatttatgatggaaatagtgaaaatcgcgttggacctgaactgttaacaccgttgggaaatttcgattgtagcggccaagatggtgataataagcgaagtcgtgataaagttgatgaagagtttcaaattggattggcagaccctgaatttgtgaaaaggagaggatatttatctgaaaattttggtcgcaaaatcaaactaatgacgaatcatttttcgttccaatattccccagatgttcaaatttatcattatgacttttcatggttatgttacggtaaagatggtgaagaaccaaaagaacaaaaactgaacagtgataattgttataagctattcgacgcagttatggcaaaatacccagagcatttcacttcgacgtcttcagtaggctatgatggtgcggcaaacgtgtatttaccatatgagcttgagtcggaatcaagcaatcttgctgtcccggacgttgaattggaagatggagttaaaaaaaatttcatcgtgacttttaaaggtggtaaagtcatctctttggcatcagttaaggaatattatgctggctcgaagatggatgatactaaacgcaaatctctccaagaagtcattcacattattttgaagttcccctcaagatacaatatgaaagctttaggtcgtctcgccatgtttccgatcaatgcagagagatattatttgtcaaactggatggaattggctttgggtcatagaaaatctcttcgattttcagaaattggtttgacattggtagtggatagagcatctgctgcattcctcaagtctggtaatggtttagactttgtaaaatctataattgatcgccaaggaggatctctgtctacttttaaacccagtccagcgcaaatagaagccctcagaagggcgtttgctggtgttaaaatttcgactgttcatctcgggtacacaaaaaaatatgttgtgaaagatattgctgaaatcgcagctaataaagacacattcaagttaaaggaaggtgaaattgatcaggttactgtggccgatttttataaaatgaaacataagatagtcttggaataccctaatctaccttgtttgattacaagtaacaactccaaaatcccaatagaagtct

//