ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-09-01 05:21:05, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XM_013558122 4498 bp mRNA linear INV 28-FEB-2018
DEFINITION PREDICTED: Lingula anatina copper-transporting ATPase 1-like
(LOC106175926), transcript variant X3, mRNA.
ACCESSION XM_013558122
VERSION XM_013558122.2
DBLINK BioProject: PRJNA293030
KEYWORDS RefSeq.
SOURCE Lingula anatina
ORGANISM Lingula anatina
Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Brachiopoda;
Linguliformea; Lingulata; Lingulida; Linguloidea; Lingulidae;
Lingula.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NW_019775502.1) annotated using gene prediction method: Gnomon.
Also see:
Documentation of NCBI's Annotation Process
On Feb 28, 2018 this sequence version replaced XM_013558122.1.
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI
Annotation Status :: Full annotation
Annotation Name :: Lingula anatina Annotation Release
101
Annotation Version :: 101
Annotation Pipeline :: NCBI eukaryotic genome annotation
pipeline
Annotation Software Version :: 8.0
Annotation Method :: Best-placed RefSeq; Gnomon
Features Annotated :: Gene; mRNA; CDS; ncRNA
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..4498
/organism="Lingula anatina"
/mol_type="mRNA"
/isolate="Amm_Jpn"
/isolation_source="intertidal zone"
/db_xref="taxon:7574"
/chromosome="Unknown"
/sex="male"
/tissue_type="Gonads"
/dev_stage="adult"
/geo_loc_name="Japan: Amami, Kasari Bay"
/lat_lon="28.4406 N 129.6676 E"
/collection_date="2012"
/collected_by="Nori Satoh, Kazuyoshi Endo"
/identified_by="Kazuyoshi Endo"
gene 1..4498
/gene="LOC106175926"
/note="Derived by automated computational analysis using
gene prediction method: Gnomon. Supporting evidence
includes similarity to: 6 Proteins, and 100% coverage of
the annotated genomic feature by RNAseq alignments,
including 1 sample with support for all annotated introns"
/db_xref="GeneID:106175926"
CDS 4..4404
/gene="LOC106175926"
/codon_start=1
/product="copper-transporting ATPase 1-like isoform X3"
/protein_id="XP_013413576.1"
/db_xref="GeneID:106175926"
/translation="
MMSEAVISIQGMTCQSCVKNIEVNMAAFPGISTIEVSLENQEGVVSFDPTVTTAEKIAEGIDDMGFEAKVKSPGSSPQEVTIYIEGMTCQSCVKNIEGAISMRSGVKQIKVSLSQKQASIRYDPSQTNPRTLREHIDDMGFEAFLEKPKQTVNVKIGVEGMTCQSCVKNIEGNMSSKPGVRHIQVSLERKEANITYDPSVVTAQMLRDQINDMGFEATLPSNGSSTSFDEFHELAKTRSHADFGKCRLHIEGMTCQSCIKNIEGVIGEFPGVKTIKVTLETKSADVTFDSSIVTAQAVADRISDMGFDCNVADQQDEFDEIASRSAPTKSPPDGTLAKCMVDIEGMTCMSCVKNIEGTLSDEKGIAQVSVSLEEKRGTVQYDPALWSPTTVAERISDMGYDSVVHAAAIPKVPSTISTTVISIKGMTCNSCVKTIQEVISEKPGVRSIKVSLQEEQGVIQYDPDVTSPQQLRDAIDDMGFDACITDETKFPPETTVIMNGSAGPVKSTPSRGHLPKTNHGMVLQRKVDTVEEDDLEKCHLHVSGMTCASCVANIERNLLKVPGISSVLVALMAQKAEVKYDPAYMMPSQIATLVTELGYPAMLIENEGTGDGHLEIQIGGMTCSSCVHRIESHMVKQPGIKSAIVSLATNRGRFEFDPENTGPRDIMNEIRDMGYEASLVTDNSKNSAAHEHRKTTRQWRNSFLFSLILGVPCMVVMMYFMFAYMHMPGHQMAAGGSNDTADSSPGVPMVTAGLSVENLILFLLATPVQFIGGRYFYIQAYKALKHRSTNMDVLIVMATTISYVYSVIVVAVAMVMQESTSPRTFFETTPMLMVFISLGRWLEHIAKGKTSEALTKLMSLQASEALLLECDKNGQVIKEQRISVDLVHRGDILKVLPGEKIPVDGKVTEGHSMCDESLITGESMPVEKKKGSSVIGGSINQNGTLLVEATHVGADSALAQIVRLVEEAQTSKAPLQAVADTIAGYFVPGVCTISLLTAVVWVIVGYATYNQLDIHWKSESGMGKNEIIFQHAFKFAITVLAIACPCALGLATPTAVMVGTGVGATNGILIKGGEPLEIAHKVQSIVFDKTGTITRGIAELTRLTLFNTGLSKHLVIAVTGTAETSSEHPVAAAIVKYAKQALGAETLGKVLDFQAVPGCGLKCRVTNVDHLVSSMETKDILKEHTNIDRDEIQDLQDAPSSSGYEVLIGNREWMSRNMLTVTEAMDQEMSYHENKGETAVLCAINGEIVAMLAVADTVKEEAHLAVYTLKKMGLNVFLLTGDNLKTAKAIAKQVGISKVFAEVLPSHKVAKIKQLQKDGHRVAMVGDGVNDSPALAQADLGIAIGTGTDVAVEAAGVVLIRNDLLDVVAAMRLSKKTVRRIRFNFLAATIYNIVGIPVAAGALFPIGIELMPWMASAAMAASSVSVVCSSLLLKLFKMPRPEDLLTSEYKARQTSLLLFLSQLQET"
misc_feature 19..210
/gene="LOC106175926"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(37..45,52..54)
/gene="LOC106175926"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 244..432
/gene="LOC106175926"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(262..270,277..279)
/gene="LOC106175926"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 475..657
/gene="LOC106175926"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(484..492,499..501)
/gene="LOC106175926"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 742..927
/gene="LOC106175926"
/note="Copper chaperone CopZ [Inorganic ion transport and
metabolism]; Region: CopZ; COG2608"
/db_xref="CDD:442020"
misc_feature 1021..1206
/gene="LOC106175926"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(1039..1047,1054..1056)
/gene="LOC106175926"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 1261..1449
/gene="LOC106175926"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(1279..1287,1294..1296)
/gene="LOC106175926"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 1627..1806
/gene="LOC106175926"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(1636..1644,1651..1653)
/gene="LOC106175926"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 1846..2037
/gene="LOC106175926"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(1864..1872,1879..1881)
/gene="LOC106175926"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 2104..4242
/gene="LOC106175926"
/note="P-type heavy metal-transporting ATPase, similar to
human copper-transporting ATPases, ATP7A and ATP7B;
Region: P-type_ATPase_Cu-like; cd02094"
/db_xref="CDD:319783"
misc_feature order(3133..3135,3139..3141,4174..4176)
/gene="LOC106175926"
/note="putative Cu binding site [ion binding]; other site"
/db_xref="CDD:319783"
misc_feature order(3265..3273,3469..3471,3625..3633,3721..3723,
3841..3849,3907..3909,3916..3918,3925..3927,3982..3984,
3991..3993)
/gene="LOC106175926"
/note="putative ATP binding site [chemical binding]; other
site"
/db_xref="CDD:319783"
ORIGIN
aagatgatgagtgaagcagtgatcagtatccaaggcatgacttgccagtcttgtgtgaaaaatatagaagtgaacatggcagcattccctggaatatccacaattgaggtttctctagaaaaccaggaaggtgttgtaagctttgatcccaccgttaccactgcagagaagattgctgagggaatagatgacatgggttttgaagccaaagttaagtcccctgggtcctccccccaggaagtgacaatctacatagagggaatgacctgtcagtcttgtgtcaaaaacatagagggtgccatcagcatgaggtcaggggtcaagcagatcaaggtatcattatcgcagaaacaggcgagcataaggtatgacccctctcagaccaatcctagaactctacgtgaacacatcgacgatatgggttttgaggcttttctggaaaaaccgaagcagacggtgaatgtgaaaattggagtagagggtatgacctgccagtcttgtgtcaagaatattgaagggaatatgtccagcaaaccgggagtgaggcacattcaagtttccctggagagaaaagaggccaatatcacgtatgacccctccgttgttacagcacagatgttacgagatcaaatcaatgacatggggtttgaggcaacacttcccagcaatggatcctcaacatcttttgatgaatttcatgaactcgctaagacaagaagccatgctgactttggcaaatgtaggttacacattgaggggatgacttgtcagtcgtgcattaagaacattgaaggggttatcggtgaattcccaggagtgaaaactatcaaggtgactttggagaccaaatctgctgatgttacttttgactccagcattgttactgcccaggcagtggcggatagaatatctgatatgggtttcgactgcaatgtggctgaccaacaggatgagtttgatgaaatagccagtagaagtgctcccacaaaatctcccccagatggcactctagccaagtgtatggttgatattgaagggatgacctgtatgtcttgtgttaagaacatcgagggtactctttctgatgagaaggggatcgcacaagtcagtgtttctctggaagagaaaaggggtacagtgcagtatgatcccgccctctggtcccccaccactgtggccgagagaatcagtgacatgggctatgattctgtagtccatgctgcagccattcctaaggtgccctccactatcagcacaactgtcatctccatcaaaggaatgacatgcaattcctgtgtgaagacaatccaggaagtgatttctgagaaaccaggggtgagatctataaaagtgtctctgcaggaagagcagggagttatccaatatgatcctgacgtcacgtcaccccagcagctgcgagacgccatagatgatatgggctttgatgcatgcatcacagatgagaccaaattcccaccagaaaccaccgtgataatgaacggcagtgcagggccagtgaagtccacgccttcacgcggccatctacccaagaccaaccatggcatggtcctacaaaggaaggtggacacagtggaagaggatgacctggagaaatgccacctccatgtgtctggaatgacctgtgcttcttgtgtggctaatattgagaggaacttactgaaagtgcctggtatttcttcagtgttggtggctttgatggcccagaaagcagaagtgaagtatgatcctgcctacatgatgccctcccagattgctaccctggtcacagaactgggctaccccgccatgctgatcgagaatgaaggaacaggtgatgggcaccttgaaatccagattggtggtatgacatgttcatcctgtgtccaccgtatagagtcccatatggtgaaacaaccaggcatcaagtctgccatagtttccctggctaccaataggggacgctttgagtttgatccagaaaacacaggaccaagagatattatgaatgaaataagggatatgggatatgaggcttccctggtcacagacaattccaagaattctgctgcacatgaacacaggaaaactaccaggcagtggagaaattcattcctgttttccctcatacttggtgtaccttgtatggtggtcatgatgtacttcatgtttgcttatatgcacatgcctggtcaccagatggcagcaggtggcagtaatgatacagctgattcctcgccaggtgtccccatggtgacagcaggactgtctgtggagaacttgattctatttttactggcaactcctgtacagtttattggtgggagatatttttatatccaagcctacaaagctttgaaacacagatccaccaatatggatgtccttattgtcatggcaaccacaatatcatatgtttactcagttattgttgtggctgttgccatggtgatgcaagagtccacaagcccacgtacattctttgagaccacacctatgttaatggtgtttatatcattgggacggtggcttgaacatatagcaaagggcaagacatcagaggccctgaccaagctgatgtctctgcaggccagtgaggctctactgctggagtgtgacaagaatggccaggtgatcaaggaacagaggatcagtgtggacttagttcacaggggagatattctcaaggtcctgcctggagagaagattccagtggatggtaaagtgacggagggacactccatgtgtgatgaatctcttatcactggagagtccatgcccgtggagaagaaaaaaggttcttctgtgattggaggatctatcaaccagaatggcactctgttggtggaagctacacatgtgggggcagacagtgctcttgctcaaatagtcaggcttgtggaagaagctcaaacatccaaagctcctctgcaggcagtggcagacaccatagctggctattttgtccctggggtttgcaccatctctctcctcacagctgtagtatgggttatagtgggctatgccacttataaccagttggacattcattggaaatcagaaagtggaatgggcaagaacgaaatcatcttccagcatgcgtttaagtttgccatcacagttctagcaatagcctgtccctgtgccctgggcctggccacacccactgctgttatggtggggacaggggtgggggctactaacgggatactcatcaagggaggagagccattagagattgcacacaaggtacagagtattgtgtttgacaagacaggcacaataacgcgtggtatagcagagttgactagactgacactgtttaatacagggttgtccaaacatctggtgattgctgtcactgggactgcagaaaccagcagtgaacaccctgtagctgcagccattgtcaaatatgccaaacaggcattgggtgcagagaccctgggcaaggtgttggatttccaagctgtcccaggctgtggcttgaagtgtagagtgaccaatgttgatcatctggtgagcagtatggaaacaaaggacattctcaaagaacacactaatattgacagagacgaaatacaagacctgcaagatgccccatcctccagtggctatgaggtattgataggtaacagggagtggatgagccgtaacatgctgacagtcactgaggccatggaccaggaaatgtcatatcatgaaaacaagggagaaactgcagtactctgtgcaattaatggtgagatagttgccatgctggccgtggcagacacagtgaaggaagaggctcaccttgctgtgtacacactgaagaaaatgggactcaatgttttcctcctcacaggagacaatctcaagacagctaaggcaatagccaaacaggttggcatcagtaaagtgtttgcggaagtgttaccatctcacaaagtggccaagatcaagcaactccagaaggacgggcaccgtgtggccatggtaggggatggggtcaatgattccccagccctggcacaggctgacctaggcattgccataggaacaggaactgatgttgccgtggaagcagcaggcgtggtgctaattaggaatgacctgttagatgtggtggcggccatgcgtctgtcaaagaagacagtgaggaggataaggttcaacttcctggctgctaccatctacaacatagtgggaatacctgtagctgctggtgctttattcccaattggtattgaattaatgccatggatggcctctgcagcaatggctgcctcatccgtgtctgtcgtctgctcttcattgttgctgaaacttttcaagatgccacgtcctgaagatcttctgacaagtgaatataaggccaggcaaacttcactcttactgttcctgtctcagcttcaagaaacctaacagagaggacctcctgacacaagagtactttcagaagttcagctcaggcagggacgagtatggggaggatgatatttctgtccactgcggtatg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]