2024-04-19 10:42:54, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_013382114 498 bp mRNA linear PLN 28-DEC-2023 DEFINITION Mitosporidium daphniae mitochondrial distribution and morphology protein 34 (DI09_43p160), partial mRNA. ACCESSION XM_013382114 VERSION XM_013382114.1 DBLINK BioProject: PRJNA292596 BioSample: SAMN02714227 KEYWORDS RefSeq. SOURCE Mitosporidium daphniae ORGANISM Mitosporidium daphniae Eukaryota; Fungi; Fungi incertae sedis; Microsporidia; Mitosporidium. REFERENCE 1 (bases 1 to 498) AUTHORS Haag,K.L., James,T.Y., Pombert,J.F., Larsson,R., Schaer,T.M., Refardt,D. and Ebert,D. TITLE Evolution of a morphological novelty occurred before genome compaction in a lineage of extreme parasites JOURNAL Proc. Natl. Acad. Sci. U.S.A. 111 (43), 15480-15485 (2014) PUBMED 25313038 REFERENCE 2 (bases 1 to 498) AUTHORS Haag,K.L., James,T.Y., Larsson,R., Schaer,T.M., Refardt,D., Pombert,J.-F. and Ebert,D. TITLE A new species of microsporidia sheds light on the evolution of extreme parasitism JOURNAL Unpublished REFERENCE 3 (bases 1 to 498) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (28-DEC-2023) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 4 (bases 1 to 498) AUTHORS Haag,K.L., James,T.Y., Larsson,R., Schaer,T.M., Refardt,D., Pombert,J.-F. and Ebert,D. TITLE Direct Submission JOURNAL Submitted (24-APR-2014) Biology, Illinois Institute of Technology, 3105 South Dearborn, Chicago, IL 60616, USA COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NW_013546356). COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..498 /organism="Mitosporidium daphniae" /mol_type="mRNA" /strain="UGP3" /host="Daphnia magna" /type_material="reference material of Mitosporidium daphniae" /db_xref="taxon:1485682" /chromosome="Unknown" /tissue_type="spores" /country="United Kingdom: Kaimes" gene <1..>498 /locus_tag="DI09_43p160" /db_xref="GeneID:25259970" CDS 1..498 /locus_tag="DI09_43p160" /codon_start=1 /product="mitochondrial distribution and morphology protein 34" /protein_id="XP_013237568.1" /db_xref="GeneID:25259970" /translation="
MLSAGDKGSVFWPGEVSILEIAELSMHRARILARISYASDGYIVINTHVQANPLCGTRGASYEDWMSSVKMDTPPQPILAADKSLVVPMVIRITDLHVDGIIWLCWTDQSPHFSLAFVSDPLVNVSVSSSFDCMAKVKQSLQEEIEQEIRKALLKTIPEAARSYR"
misc_feature <22..477 /locus_tag="DI09_43p160" /note="synaptotagmin-like mitochondrial-lipid-binding protein (SMP) domain superfamily; Region: SMP_SF; cl45903" /db_xref="CDD:459248" ORIGIN
atgctctcagctggtgataaaggatctgtattttggccaggagaagttagcattttggaaatcgcggaactttctatgcacagagctagaattttagcccgaatatcatatgcctcagatggatatattgtcatcaacacacatgtgcaggcgaatccgctttgtggtacacgaggggcctcatatgaggattggatgtcttcggtcaagatggacacgccgccccagccgatccttgctgcggacaagagcctggtcgttccaatggttatcagaataactgacctccacgtggatggcatcatatggctttgctggaccgatcaatctccgcatttctctctagcatttgtgtccgacccgctcgttaatgtttccgtgtcttcttctttcgattgcatggcaaaggtaaagcaatctctccaagaagagattgaacaggaaattagaaaagcactattgaagacgattccagaggcagctcggtcctaccgatga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]