ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-09-23 14:29:04, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XM_010124323 1623 bp mRNA linear VRT 07-NOV-2014 DEFINITION PREDICTED: Chlamydotis macqueenii testis- and ovary-specific PAZ domain-containing protein 1-like (LOC104482764), partial mRNA. ACCESSION XM_010124323 VERSION XM_010124323.1 DBLINK BioProject: PRJNA266006 KEYWORDS RefSeq; includes ab initio. SOURCE Chlamydotis macqueenii (Macqueen's bustard) ORGANISM Chlamydotis macqueenii Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Neoaves; Otidimorphae; Otidiformes; Otididae; Chlamydotis. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_010488148.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Chlamydotis macqueenii Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.1 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## ##RefSeq-Attributes-START## ab initio :: 9% of CDS bases ##RefSeq-Attributes-END## COMPLETENESS: incomplete on the 5' end. FEATURES Location/Qualifiers source 1..1623 /organism="Chlamydotis macqueenii" /mol_type="mRNA" /isolate="BGI_N324" /db_xref="taxon:187382" /chromosome="Unknown" /sex="male" gene <1..1623 /gene="LOC104482764" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 Protein" /db_xref="GeneID:104482764" CDS <1..1623 /gene="LOC104482764" /codon_start=1 /product="testis- and ovary-specific PAZ domain-containing protein 1-like" /protein_id="XP_010122625.1" /db_xref="GeneID:104482764" /translation="
ASHSVQHILEMIELPRKYCRFYFSTLRGCERAKCWFWHVPEQGDEKPAVDVVLKVFEHVASLNIRNAVPTLISTFCKLIDAGMLLEFEHFDYIIKLLHQLHASSQELNTVLNMKSRFQERYFGKNWLFDFNLAVAEIQHCKEKSDWTKLGALYVNARTGCEHFHDLQKLSLCISEILTRDSETDRPGVPFCDFADAVIKNSQHNEAHRIFIGRTGISVMCSYHKALQWIKGRKVLDKLHELQIHFTVLKGLTGAERFASRCQIVNKAAEIFLKTGSLDGATWVLRESEWTINAPLWPCDKMDILNRHNLLCTLVHKCLKKSLYRQAFEVLQNLPGFQNHSDTVDVSQYSCLFNKLINACFESKNLGVSSSAVDFMLSKNIAIDFILLRGLITALGRSSLWSKARTYYKSALSLGCYPPLQGNLYHKVLTIPSYLSEVEMLLAIEIFLVSNASDIQSPMVSSQTLQIILKRCEDQTVQNNSDYQAAVERLVLAARISDPKLFLKHMTMNVNMEEVYSLELTSALKWLQENMKWAGKVWLFH"
misc_feature 409..936
/gene="LOC104482764"
/note="Putative aspartate racemase; Region:
Asp_Glu_race_2; pfam14669"
/db_xref="CDD:464250"
misc_feature 934..1008
/gene="LOC104482764"
/note="PPR repeat [structural motif]; Region: PPR repeat"
/db_xref="CDD:276811"
misc_feature 1024..1134
/gene="LOC104482764"
/note="PPR repeat [structural motif]; Region: PPR repeat"
/db_xref="CDD:276811"
misc_feature 1150..1224
/gene="LOC104482764"
/note="PPR repeat [structural motif]; Region: PPR repeat"
/db_xref="CDD:276811"
ORIGIN
gcttctcattcagtccagcacatcctcgagatgattgaattgccccgtaaatattgcagattttatttctcaactttacgtgggtgtgaaagagcaaaatgctggttttggcatgttcctgaacaaggggatgaaaagccagctgtagatgttgttctgaaagtctttgagcatgtggcttctttgaatatacgaaatgcggtgcctacattaatcagtaccttttgtaagctaattgatgctggtatgctccttgagtttgaacattttgactatattattaagttgcttcaccaattgcacgcttccagtcaggaactaaatactgttttgaacatgaaatccagatttcaggaaagatattttggaaagaactggctttttgacttcaacttggcagtggctgaaattcagcattgcaaggaaaaaagtgattggacaaagctgggagctttgtatgttaatgcaagaactggatgtgaacattttcatgatcttcagaagttgtctttatgtatttctgaaatactaaccagagattctgagacagacagaccaggagttcctttttgtgattttgctgatgcagtaataaaaaattcacaacataatgaagcacacagaattttcattggaaggactggaataagtgtaatgtgttcttaccacaaagcactgcagtggataaagggaaggaaggttttggataaattgcatgagctacagatacattttacagttttgaaaggacttacaggtgcagagagatttgcatcaagatgtcaaattgttaataaagctgcagaaatttttcttaaaactggaagtctggatggagcgacatgggtattgagagagtcagagtggaccataaatgcaccattgtggccctgtgataagatggacatcctcaatcgacataatctgttatgtacgctggtgcacaagtgcttgaagaagagtttatacaggcaggcatttgaagttctgcagaacttaccaggttttcaaaatcactctgatactgtagatgtttctcagtacagctgcctttttaacaagctgataaatgcctgttttgagagcaagaaccttggcgtctcatcttctgcagtagacttcatgctttcaaaaaacatagctattgattttattttacttagaggattaatcacagctttgggaagaagttctttgtggtctaaagctaggacctattacaaaagtgctttatcattgggttgctacccaccactgcagggaaatttatatcacaaagttttgacgattccgtcttacctgtctgaggttgagatgctgttggccattgaaatatttcttgtttcaaatgccagtgatattcaaagtccaatggtttctagtcaaactcttcaaataatactgaaaagatgtgaagatcagacagttcagaataacagtgactatcaagcggcagtggagagactggtcctggctgctcgcatatctgatccaaagctttttcttaagcatatgacaatgaatgtgaatatggaagaagtttacagcttggagctcacatctgctctaaaatggcttcaggagaatatgaaatgggctgggaaggtctggctgtttcactag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]