LOCUS       XM_005789417            2829 bp    mRNA    linear   PLN 07-APR-2015
DEFINITION  Emiliania huxleyi CCMP1516 Argonaute (Argonaute), partial mRNA.
ACCESSION   XM_005789417
VERSION     XM_005789417.1
DBLINK      BioProject: PRJNA222302
            BioSample: SAMN02744062
KEYWORDS    RefSeq.
SOURCE      Emiliania huxleyi CCMP1516
  ORGANISM  Emiliania huxleyi CCMP1516
            Eukaryota; Haptista; Haptophyta; Prymnesiophyceae; Isochrysidales;
            Noelaerhabdaceae; Emiliania.
REFERENCE   1  (bases 1 to 2829)
  AUTHORS   Read,B., Kegel,J., Klute,M., Kuo,A., Lefebvre,S.C., Maumus,F.,
            Mayer,C., Miller,J., Allen,A., Bidle,K., Borodovsky,M., Bowler,C.,
            Brownlee,C., Claverie,J.-M., Cock,M., De Vargas,C., Elias,M.,
            Frickenhaus,S., Gladyshev,V.N., Gonzalez,K., Guda,C., Hadaegh,A.,
            Herman,E., Iglesias-Rodriguez,D., Jones,B., Lawson,T., Leese,F.,
            Lin,Y.-C., Lindquist,E., Lobanov,A., Lucas,S., Malik,S.-H.B.,
            Marsh,M.E., Mock,T., Monier,A., Moreau,H., Mueller-Roeber,B.,
            Napier,J., Ogata,H., Parker,M., Probert,I., Quesneville,H.,
            Raines,C., Rensing,S., Riano-Pachon,D.M., Richier,S., Rokitta,S.,
            Salamov,A., Sarno,A.F., Schmutz,J., Schroeder,D., Shiraiwa,Y.,
            Soanes,D.M., Valentin,K., Van Der Giezen,M., Van Der Peer,Y.,
            Vardi,A., Verret,F., Von Dassow,P., Wheeler,G., Williams,B.,
            Wilson,W., Wolfe,G., Wurch,L.L., Young,J., Dacks,J.B.,
            Delwiche,C.F., Dyhrman,S., Glockner,G., John,U., Richards,T.,
            Worden,A.Z., Zhang,X. and Grigoriev,I.V.
  CONSRTM   DOE Joint Genome Institute
  TITLE     Genome variability drives Emilianias global distribution
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 2829)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (03-APR-2015) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 2829)
  AUTHORS   Kuo,A., Read,B., Kegel,J., Klute,M., Lefebvre,S.C., Maumus,F.,
            Mayer,C., Miller,J., Allen,A., Bidle,K., Borodovsky,M., Bowler,C.,
            Brownlee,C., Claverie,J.-M., Cock,M., De Vargas,C., Elias,M.,
            Frickenhaus,S., Gladyshev,V.N., Gonzalez,K., Guda,C., Hadaegh,A.,
            Herman,E., Iglesias-Rodriguez,D., Jones,B., Lawson,T., Leese,F.,
            Lin,Y.-C., Lindquist,E., Lobanov,A., Lucas,S., Malik,S.-H.B.,
            Marsh,M.E., Mock,T., Monier,A., Moreau,H., Mueller-Roeber,B.,
            Napier,J., Ogata,H., Parker,M., Probert,I., Quesneville,H.,
            Raines,C., Rensing,S., Riano-Pachon,D.M., Richier,S., Rokitta,S.,
            Salamov,A., Sarno,A.F., Schmutz,J., Schroeder,D., Shiraiwa,Y.,
            Soanes,D.M., Valentin,K., Van Der Giezen,M., Van Der Peer,Y.,
            Vardi,A., Verret,F., Von Dassow,P., Wheeler,G., Williams,B.,
            Wilson,W., Wolfe,G., Wurch,L.L., Young,J., Dacks,J.B.,
            Delwiche,C.F., Dyhrman,S., Glockner,G., John,U., Richards,T.,
            Worden,A.Z., Zhang,X. and Grigoriev,I.V.
  CONSRTM   DOE Joint Genome Institute
  TITLE     Direct Submission
  JOURNAL   Submitted (09-JUL-2012) DOE Joint Genome Institute, 2800 Mitchell
            Drive, Walnut Creek, CA 94598-1698, USA
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_005201298).
            
            ##Metadata-START##
            Organism Display Name :: Emiliania huxleyi CCMP1516 main genome
                                     assembly v1.0
            GOLD Stamp ID         :: Gi13848
            ##Metadata-END##
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..2829
                     /organism="Emiliania huxleyi CCMP1516"
                     /mol_type="mRNA"
                     /strain="CCMP1516"
                     /db_xref="taxon:280463"
                     /chromosome="Unknown"
     gene            <1..>2829
                     /gene="Argonaute"
                     /locus_tag="EMIHUDRAFT_226029"
                     /db_xref="GeneID:17282315"
     CDS             1..2829
                     /gene="Argonaute"
                     /locus_tag="EMIHUDRAFT_226029"
                     /note="Argonaute proteins are the catalytic components of
                     the RNA-induced silencing complex (RISC), the protein
                     complex responsible for the gene silencing phenomenon
                     known as RNA interference (RNAi). Argonaute proteins bind
                     small interfering RNA (siRNA) fragments and have
                     endonuclease activity directed against messenger RNA
                     (mRNA) strands that are complementary to their bound siRNA
                     fragment."
                     /codon_start=1
                     /product="Argonaute"
                     /protein_id="XP_005789474.1"
                     /db_xref="GeneID:17282315"
                     /db_xref="InterPro:IPR003165"
                     /db_xref="JGIDB:Emihu1_226029"
                     /translation="

MADGITSVMTYSSKRDDYVEVFSFDRAKDPRLASLPATVRFEKEAYTKHVHAPALGGQAEIEFEQRCDCKSAEKFVEHMKGSQRCLIGAEAAQRLQQWPRGGVALRPDGGGTLGKPVRLFSNFSPVRVREGGVEVHQYSLAYLKGEGEELELRTTQRRRDVLLEFKDNIDVAFGVREGAAWVWDGDKIFISTRRIDSLSMERPGLKLTWQYARSLRLEGDHREVYDLVLRHEQSMMFKAVGKAIFNPDRQTWRDRFQNLNKTLWLGHRQSVVRGEGGTPMLLVDKAVTCVLRPVKLIEFLCVELGLRQHRKLSTQELAAELRKPKVLADYAEWSQRWEEHKRKGKSGIGPSRPLTDVSDKLPREHFFETPQELRQQHPAAEISVQDFFRLRYGIELKHPELVLVGFGKGGRNLVPMELCDFVGGEAARLATADERSKLVKETSQPPAQRLEEIRTLQRDVGRDATCRAFGLEVGPLLDNVPGRVLPVMSLGYGPENNPRVAIPEAGGKFRGNWRTPPGATYIRPGNVQRCVVGLFPPSGKDHQHFLDVGGLQRGLSGLIADAGKLGLNLDFGPLVRLEGREVRLQDPSLLMCLRDTSSAEEVEQELARAFGELGDNAWQHPIRATNKALCSRIGIAVQHCKGYWSNLLDKLNLKALGTNYYPLCEVPGGGLQPGLQLLRECPTLLLGCDVHHAAPGSSRPSYGALVGTVDKFFSSHYTEVRAMTGRQECIPVDDMQSMVREQLKAFYRYNGIPPQRIICYRDGVAHNQFEEVHEVEIHAIERACHAIEQGYQPQIVFIVEQKGGGARFFANENGRVPGQQMGNQPPLTVVDTVVVDESTFSFHLTPHHGMKGTSRGNLYSVLRNDPNLSSDDLQRFTSQLCHLFQRCKKIVSKVAPNYNAHLAAEMWGLKEERESFSDTASVSSDAAACDVHERLKTRLFYT"

     misc_feature    877..1266
                     /gene="Argonaute"
                     /locus_tag="EMIHUDRAFT_226029"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(1027..1029,1099..1101,1150..1152,1162..1164,
                     1216..1218,1234..1236,1240..1242)
                     /gene="Argonaute"
                     /locus_tag="EMIHUDRAFT_226029"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1399..2715
                     /gene="Argonaute"
                     /locus_tag="EMIHUDRAFT_226029"
                     /note="PIWI domain. Domain found in proteins involved in
                     RNA silencing. RNA silencing refers to a group of related
                     gene-silencing mechanisms mediated by short RNA molecules,
                     including siRNAs, miRNAs, and heterochromatin-related
                     guide RNAs. The central component...; Region: Piwi-like;
                     cl00628"
                     /db_xref="CDD:412485"
     misc_feature    order(1828..1830,1879..1881,1912..1923,1927..1929,
                     1936..1938,1948..1950,1960..1962)
                     /gene="Argonaute"
                     /locus_tag="EMIHUDRAFT_226029"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:239208"
     misc_feature    order(2065..2067,2071..2073,2284..2286,2701..2703)
                     /gene="Argonaute"
                     /locus_tag="EMIHUDRAFT_226029"
                     /note="active site"
                     /db_xref="CDD:239208"
ORIGIN      

atggctgatggaatcaccagtgtgatgacgtactcgtccaagagggatgattacgtggaggtcttcagcttcgaccgcgctaaggacccgcgcctcgcatctctgccggcaacggtgcgttttgagaaggaggcctacacgaagcatgtgcatgctcccgccctcgggggacaggctgagatcgagttcgagcagcgttgcgactgcaagtccgccgagaagttcgtggagcatatgaaggggagccagagatgccttatcggcgccgaggccgcgcagcggctgcagcagtggccgaggggaggggtcgcgctgcggccggacgggggagggacgcttggcaagcccgtccggctcttctccaacttctcgcccgtccgcgtgagggaaggcggcgtggaggtgcaccagtactcgctggcgtacctcaagggcgagggagaggagctcgagctccggacaacgcagcggcggcgcgacgtgctcctcgagttcaaggacaacatcgacgtcgcttttggcgtccgcgagggggcagcgtgggtgtgggacggggacaagatcttcatctcgacgcggcggatcgacagcctctcgatggagcggcccggcctcaagctgacgtggcagtacgcgaggtcgctccggctcgagggcgaccaccgggaggtgtacgacctcgtgctgcggcatgagcagtcgatgatgttcaaggcggtcggcaaggccatcttcaacccggaccggcagacctggcgagacaggttccagaacctgaacaagacgctgtggctcggccaccggcagagcgttgtccgcggcgagggcggcacgcctatgctgctcgtcgacaaggcggtcacttgcgtgctgcggccggttaaactcatcgagtttctctgcgtcgagctcgggctgcggcagcaccgcaagctgagcacgcaagagctggccgccgagctgcgcaagccaaaggtgctcgccgactacgcggagtggagccagcgctgggaggagcacaagcgcaagggcaagagcggcatcggtccgagccgccccctcaccgacgtgagcgacaagctgccgcgcgagcacttcttcgagacaccccaggagctgcggcagcagcaccccgcggctgagatctcggtgcaggacttctttcggctgcggtacggcatcgagctgaagcaccccgagctggttctggtcgggtttgggaaaggcggccgtaacctcgtcccgatggagctgtgcgacttcgtcgggggcgaggcggcgcggctggccacggcggatgagcgctccaagctggtcaaggagacctcgcagcctccggcgcagcgactcgaagagattcggacattgcagagagacgtcggccgcgacgccacttgccgcgcgttcgggctcgaggtcggaccgctgctggacaacgtgcccggccgcgtccttccggtgatgagcctcgggtacgggcccgagaacaacccgcgtgtcgcgattccagaggcgggcggcaagttccgcggcaactggcgcaccccgcccggcgccacgtacatccgacctggaaacgtgcagcggtgcgtggtgggccttttcccgccatccggcaaggatcaccagcacttcctcgacgtgggcgggctgcagcgtgggctcagcgggctgattgcggatgcggggaagctgggcctgaatctcgactttgggcccctcgtccgcctcgaggggagggaggtccggcttcaggacccctcgctgctgatgtgcctccgggacacgtccagcgccgaggaggtggagcaggagctggcgcgcgcctttggcgagctgggggacaatgcgtggcagcaccccatccgggcgaccaacaaggcgctctgctcgcgcatcggcatcgcggtgcaacactgcaagggctactggagcaacctgctggacaagctcaacctcaaggcgctcggcacaaactactacccgctgtgcgaggtgcccggcggcggcttgcagcccggcttgcagctgctgcgggagtgcccgacgttgctgctcggctgcgatgtccaccacgccgcgcccggctcgagcaggccctcctacggcgcgctggtcggcacggtggacaaattcttctcttcccactacaccgaggtgcgggcaatgactggccggcaggagtgcatcccggtagacgacatgcagagcatggtgcgcgagcagctgaaggccttctaccggtacaacggcatacctccccagcgcatcatctgctatcgcgacggcgtggcgcacaaccagttcgaggaggtgcacgaggtcgagatacacgcgattgagcgggcgtgccacgcgattgagcaggggtaccagcctcagatcgtcttcatcgtggagcagaagggcggcggcgcgcgcttctttgcgaacgagaatgggcgcgtgcccggccagcagatgggcaaccagcctcctctcacggtggtcgacactgtggtggtggacgagtcgaccttcagcttccacttgacccctcaccacggcatgaaggggacgtctcgcggcaacctgtactctgtgctgcgcaacgaccccaacctctcctccgacgacctgcagcgcttcacgagccagctctgccacctcttccagcgctgcaagaagatcgtctccaaggttgccccaaactacaacgctcacctcgctgcggagatgtgggggctcaaggaggagcgcgaaagcttctccgacacggcctcggtcagcagcgacgccgccgcatgcgacgtgcacgagcgcctgaagacgcgtctcttctacacatga

//