GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-04 14:06:19, GGRNA.v2 : RefSeq release 228 (Jan, 2025)

LOCUS       XM_005325745            3595 bp    mRNA    linear   ROD 22-MAR-2021
DEFINITION  PREDICTED: Ictidomys tridecemlineatus nuclear factor kappa B
            subunit 1 (Nfkb1), transcript variant X1, mRNA.
ACCESSION   XM_005325745
VERSION     XM_005325745.3
DBLINK      BioProject: PRJNA714113
KEYWORDS    RefSeq.
SOURCE      Ictidomys tridecemlineatus (thirteen-lined ground squirrel)
  ORGANISM  Ictidomys tridecemlineatus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia;
            Sciuromorpha; Sciuridae; Xerinae; Marmotini; Ictidomys.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_024405301.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Mar 22, 2021 this sequence version replaced XM_005325745.2.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Ictidomys tridecemlineatus
                                           Annotation Release 103
            Annotation Version          :: 103
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.6
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3595
                     /organism="Ictidomys tridecemlineatus"
                     /mol_type="mRNA"
                     /isolate="GS200"
                     /db_xref="taxon:43179"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="liver"
                     /collection_date="2010"
                     /collected_by="Sandy Martin, University of Colorado,
                     Anschutz Medical Campus"
     gene            1..3595
                     /gene="Nfkb1"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 10 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 72 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:101972573"
     CDS             27..2948
                     /gene="Nfkb1"
                     /codon_start=1
                     /product="nuclear factor NF-kappa-B p105 subunit isoform
                     X1"
                     /protein_id="XP_005325802.1"
                     /db_xref="GeneID:101972573"
                     /translation="
MAGNNPYGGMPEQIFHLNPLPHTIFNPELFPPEMPLPTADGPYLQILEQPKQRGFRFRYVCEGPSHGGLPGASSEKNKKSYPQVKICNYVGPAKVIVQLVTNGKNIHLHAHSLVGKHCEDGICTVNAGPKDMVVGFANLGILHVTKKKVFETLEARMTDACVRGYNPGLLVHPDLAYLQAEGGGDRQLTDREKELIRQAALQQTKEMDLSVVRLMFTAFLPDSTGSFTRRLEPVVSDAIYDSKAPNASNLKIVRMDRTAGCVTGGEEIYLLCDKVQKDDIQIRFYEEEENGGVWEGFGDFSPTDVHRQFAIVFKTPKYKDVNITKPASVFVQLRRKSDLETSEPKPFLYYPEIKDKEEVQRKRQKLMPNFSDSFGGGSGAGAGGGGMFGSGGGGGSTGSTGPGYGFPHYGFPTYGGITFHPGTTKSNAGLKHGTMNDVSKRDPEDCGKSGGREIVNLSGNIIKTTEQDKLGMSMDRNEEVTLLCTRGVKEEDSLFQDNLFLEKAMQLAKRHANALFDYAVTGDVKMLLAVQRHLTAVQDENGDSVLHLAIIHLHAQLVRDLLEVTSGLISDDIINMRNDLYQTPLHLAVITKQEDVVEDLLSAGADLSLLDRLGNSVLHLAAKEGHDKVLSVLLKHKKAALLIDHPNGEGLNAIHIAVMSNSLPCLLLLVAAGADVNAQEQKSGRTALHLAVEHDNISLAGCLLLEGDAHVDSTTYDGTTPLHIAAGRGSTKLAALLKAAGADPLVENFEPLYDLDDSWEKAGEDEGVVPGTTPLDMAANWQVFDILNGKPYEPEFTSEDLLAQGDMKQLTEDAKLQLYKLLEIPDPDKNWATLAQKLGLGILNNAFRLSPAPSKTLMDNYEVSGGTIKELVEALRQMGYTEAIQVIQAAFCTSEASSPVKTTSQAHSLPFLPSSTRQQIDELRDNDSICDSGVETSFRKLSFTESLTSSSSLLTLNKMPHDYGQEGPIEGKI"
     misc_feature    150..755
                     /gene="Nfkb1"
                     /note="N-terminal sub-domain of the Rel homology domain
                     (RHD) of nuclear factor of kappa B1 (NF-kappa B1); Region:
                     RHD-n_NFkB1; cd07935"
                     /db_xref="CDD:143651"
     misc_feature    order(192..194,198..203,207..212,219..230,453..455,
                     459..464,753..755)
                     /gene="Nfkb1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:143651"
     misc_feature    774..1079
                     /gene="Nfkb1"
                     /note="IPT domain of the transcription factor NFkappaB and
                     related transcription factors. NFkappaB is considered a
                     central regulator of stress responses, activated by
                     different stressful conditions, including physical stress,
                     oxidative stress, and exposure to...; Region:
                     IPT_NFkappaB; cd01177"
                     /db_xref="CDD:238582"
     misc_feature    order(777..779,783..791,795..803,921..929,966..968,
                     1002..1004,1059..1061,1068..1070,1074..1076)
                     /gene="Nfkb1"
                     /note="ankyrin protein binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:238582"
     misc_feature    order(783..788,792..794,831..833,837..839,843..845,
                     942..947,954..956,960..962)
                     /gene="Nfkb1"
                     /note="dimerization interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:238582"
     misc_feature    order(846..848,852..854,945..950)
                     /gene="Nfkb1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238582"
     misc_feature    1509..2297
                     /gene="Nfkb1"
                     /note="Ankyrin repeat [Signal transduction mechanisms];
                     Region: ANKYR; COG0666"
                     /db_xref="CDD:440430"
     misc_feature    order(1647..1649,1653..1655,1665..1670,1677..1685,
                     1689..1694,1704..1706,1713..1715,1758..1760,1764..1766,
                     1770..1772,1782..1787,1794..1802,1806..1811,1821..1823,
                     1830..1832,1857..1859,1863..1865,1869..1871,1881..1886,
                     1893..1901,1905..1910,1920..1922,1929..1931)
                     /gene="Nfkb1"
                     /note="oligomer interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:293786"
     misc_feature    1647..1760
                     /gene="Nfkb1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    1764..1859
                     /gene="Nfkb1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    1971..2063
                     /gene="Nfkb1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2073..2171
                     /gene="Nfkb1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2469..2693
                     /gene="Nfkb1"
                     /note="Death domain of the Nuclear Factor-KappaB1
                     precursor protein p105; Region: Death_NFkB1_p105; cd08797"
                     /db_xref="CDD:260063"
ORIGIN      
gcgcggacccgccaccaggctccagaatggcaggaaacaatccatacgggggaatgcctgaacaaatatttcacttgaatcctttgcctcatactatatttaatccagaattatttcccccggagatgccactgcctacagcagatggcccataccttcaaatattagagcaacctaaacagagaggatttcgtttccgttatgtttgtgaaggcccatcccatggcggacttcctggtgcatctagtgagaagaacaagaagtcctaccctcaggttaaaatttgcaactatgtgggacctgcaaaggtgattgttcagttggtcacaaatgggaaaaatatccacctgcacgcccacagcctggtgggaaaacactgtgaggatggaatctgcactgtgaatgccggacccaaggacatggtggtcggctttgcaaacctgggtatacttcatgtgacaaagaaaaaagtatttgaaacactggaagcacggatgacagacgcgtgtgtcaggggctacaatccgggacttctcgtgcatcctgaccttgcctatttgcaagcagaaggtggaggagaccggcagctcacagatcgggaaaaggagctcatccgccaggcggctcttcagcagactaaggagatggacctcagcgtggtgcggctcatgtttacagcttttcttcccgacagcaccggcagcttcaccaggcgcctggaacccgtggtgtcagacgccatctatgacagcaaagcccccaatgcatccaatttgaaaattgtaagaatggacaggacagctggatgtgtaactggaggggaagaaatttatcttctctgtgacaaagttcagaaagatgatatccagattcggttttatgaagaggaggaaaatggtggagtttgggaaggatttggagatttctcccccacagatgttcatagacaattcgccatcgtcttcaaaaccccaaagtataaagatgtcaacattacaaagccagcctctgtcttcgtccagcttcggagaaaatctgatttggaaactagtgaaccaaaaccttttctctactaccctgaaatcaaagataaagaggaagtgcagaggaaacggcagaagctcatgcccaatttttcagatagtttcggcggcggcagtggtgccggggctggaggtggaggcatgttcggtagcggcggtggaggagggagcactggaagtacgggtccagggtacggcttcccgcactatggatttcctacatacggtggaattaccttccaccctggaaccactaaatccaatgctgggctgaagcatggaaccatgaatgatgtatctaaaagggatcctgaagattgtggcaagagtggtggcagagagattgtaaatctctctgggaacattatcaaaaccacagaacaagataaactgggcatgtccatggacagaaatgaggaggtgacgctgctgtgcaccaggggagtaaaggaagaggactctctgtttcaggataacctctttctggagaaggctatgcagcttgccaagcggcatgccaacgcccttttcgactatgcggtgacgggagatgtgaagatgctgctggctgtccagcggcacctcactgcagtgcaggatgagaatggggacagtgtcttacacttagccatcatccaccttcatgctcagcttgtgagagatctgctagaagttacatctggtttgatttctgatgacattatcaacatgagaaacgatctgtaccagacgcccttgcacttggcagtgatcactaagcaagaagatgtggtagaggacttgctgagtgccggggctgacctgagccttctggaccgcttgggtaactctgttttgcacctagctgccaaagaaggacatgataaagttctcagtgtcttactcaagcacaaaaaggcagcactacttatcgatcatcccaacggggaaggtctgaatgccattcacatagccgtgatgagcaacagcctgccgtgtctgctgctgctggtggccgccggagcagacgtcaatgctcaggagcagaagtccgggcgaacagcactgcacctggctgtggagcatgacaacatctccttggcaggctgcctgctcctggagggagatgcccacgtagacagtaccacctatgatggaactacacccctacacatcgcagccgggagagggtccaccaagctggcagctcttctaaaagcagcaggagcagatcccctggtggagaactttgagcccctttatgacctggatgactcttgggaaaaggcaggagaggacgaaggggttgtgcctggaaccacacccctagacatggccgccaactggcaggtatttgacatcttaaatgggaagccgtatgagccagagtttacatctgaggatttgctggcacaaggagacatgaaacagctgaccgaagatgcaaaactgcagctctacaagttgctagaaatccctgatccagacaaaaactgggctactctggcacagaagttaggtctggggatacttaataatgctttccggctgagtcctgctccttccaaaactctcatggacaactatgaggtctctggggggaccatcaaagagctggtagaggccctgagacagatgggctacaccgaagcaatccaagtgatccaggcggccttctgcacctcggaagcctccagccccgtgaagaccacctctcaggcccactcactgcctttcttgccttcctctacaaggcagcaaatagatgagcttcgagacaatgacagcatctgtgacagtggtgtggagacatccttccgcaaactcagctttacagagtctctgaccagcagcagctcattgctaactctcaacaaaatgccccacgattatgggcaggaaggacctatagaaggcaaaatttagccttcgggcagtttcccatgctgtgtaaaccaaagtcctaaaattccactgcattgtccaaaagaaggaaggtaaagtgcatccagaggtgctcagaggaacagcggcctgcctgaatcatgctggatttaattcaaggccgtctaaacgtggcttcctttcctggtttttcaatgagttttagttgattcacttgcagataagtatctagcaatccccctcactgcactgaactgatgtgacctggggatgaggtagtttattgagctttactggctgctgctggattacagttgctttttttgtcgtcattgctgctgtccctctgctgcattcccactgtcattaaagggtgtccccacctggtgttctttctagccgtccagggcacagttgtgcattcagattaaggattaagaaaagaggtgttttaaaatcagagtcacttagtgtgcaattaaaaaagaaaggctcattgctttttctaatgtggttatctcagtgatttggaaaaaagaagaatttatcaatatttaaacatggttataatcagtgccgaaaatgatattttcccctttttctgcattttgctattgtaaatatgtttttttttagatcaaatactttaaaggaaaaatgttggattt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]