LOCUS       NR_189664               1982 bp    RNA     linear   ROD 05-DEC-2023
DEFINITION  Mus musculus solute carrier family 35 (UDP-galactose transporter),
            member A2 (Slc35a2), transcript variant 11, non-coding RNA.
ACCESSION   NR_189664 XR_003953007
VERSION     NR_189664.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 1982)
  AUTHORS   Cheng H, Wang S, Gao D, Yu K, Chen H, Huang Y, Li M, Zhang J and
            Guo K.
  TITLE     Nucleotide sugar transporter SLC35A2 is involved in promoting
            hepatocellular carcinoma metastasis by regulating cellular
            glycosylation
  JOURNAL   Cell Oncol (Dordr) 46 (2), 283-297 (2023)
   PUBMED   36454514
  REMARK    GeneRIF: Nucleotide sugar transporter SLC35A2 is involved in
            promoting hepatocellular carcinoma metastasis by regulating
            cellular glycosylation.
REFERENCE   2  (bases 1 to 1982)
  AUTHORS   Hayashi Y, Ito Y, Yanagiba Y, Kamijima M, Naito H and Nakajima T.
  TITLE     Differences in metabolite burden of di(2-ethylhexyl)phthalate in
            pregnant and postpartum dams and their offspring in relation to
            drug-metabolizing enzymes in mice
  JOURNAL   Arch Toxicol 86 (4), 563-569 (2012)
   PUBMED   22159897
  REMARK    GeneRIF: DEHP exposure did not influence lipase activity, whereas
            it slightly enhanced UGT activity and exclusively increased CYP4A14
            levels in pregnant and/or postpartum dams.
REFERENCE   3  (bases 1 to 1982)
  AUTHORS   Oelmann S, Stanley P and Gerardy-Schahn R.
  TITLE     Point mutations identified in Lec8 Chinese hamster ovary
            glycosylation mutants that inactivate both the UDP-galactose and
            CMP-sialic acid transporters
  JOURNAL   J Biol Chem 276 (28), 26291-26300 (2001)
   PUBMED   11319223
REFERENCE   4  (bases 1 to 1982)
  AUTHORS   Means GD, Toy DY, Baum PR and Derry JM.
  TITLE     A transcript map of a 2-Mb BAC contig in the proximal portion of
            the mouse X chromosome and regional mapping of the scurfy mutation
  JOURNAL   Genomics 65 (3), 213-223 (2000)
   PUBMED   10857745
REFERENCE   5  (bases 1 to 1982)
  AUTHORS   Ishida N, Yoshioka S, Iida M, Sudo K, Miura N, Aoki K and Kawakita
            M.
  TITLE     Indispensability of transmembrane domains of Golgi UDP-galactose
            transporter as revealed by analysis of genetic defects in
            UDP-galactose transporter-deficient murine had-1 mutant cell lines
            and construction of deletion mutants
  JOURNAL   J Biochem 126 (6), 1107-1117 (1999)
   PUBMED   10578063
REFERENCE   6  (bases 1 to 1982)
  AUTHORS   Ishida N, Miura N, Yoshioka S and Kawakita M.
  TITLE     Molecular cloning and characterization of a novel isoform of the
            human UDP-galactose transporter, and of related complementary DNAs
            belonging to the nucleotide-sugar transporter gene family
  JOURNAL   J Biochem 120 (6), 1074-1078 (1996)
   PUBMED   9010752
REFERENCE   7  (bases 1 to 1982)
  AUTHORS   Lennon G, Auffray C, Polymeropoulos M and Soares MB.
  TITLE     The I.M.A.G.E. Consortium: an integrated molecular analysis of
            genomes and their expression
  JOURNAL   Genomics 33 (1), 151-152 (1996)
   PUBMED   8617505
REFERENCE   8  (bases 1 to 1982)
  AUTHORS   Hara T, Yamauchi M, Takahashi E, Hoshino M, Aoki K, Ayusawa D and
            Kawakita M.
  TITLE     The UDP-galactose translocator gene is mapped to band
            Xp11.23-p11.22 containing the Wiskott-Aldrich syndrome locus
  JOURNAL   Somat Cell Mol Genet 19 (6), 571-575 (1993)
   PUBMED   8128316
REFERENCE   9  (bases 1 to 1982)
  AUTHORS   Hara T, Hattori S and Kawakita M.
  TITLE     Isolation and characterization of mouse FM3A cell mutants which are
            devoid of Newcastle disease virus receptors
  JOURNAL   J Virol 63 (1), 182-188 (1989)
   PUBMED   2535724
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AL671978.2.
            
            On Dec 5, 2023 this sequence version replaced XR_003953007.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR7652917.33412.1,
                                           SRR17784649.50498.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00849374, SAMN00849375
                                           [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-101               AL671978.2         40630-40730
            102-284             AL671978.2         42046-42228
            285-436             AL671978.2         45909-46060
            437-1712            AL671978.2         48437-49712
            1713-1982           AL671978.2         50488-50757
FEATURES             Location/Qualifiers
     source          1..1982
                     /organism="Mus musculus"
                     /mol_type="transcribed RNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="X"
                     /map="X 3.56 cM"
     gene            1..1982
                     /gene="Slc35a2"
                     /gene_synonym="Had-1; Had1; Sfc8; Ugalt; UGT"
                     /note="solute carrier family 35 (UDP-galactose
                     transporter), member A2"
                     /db_xref="GeneID:22232"
                     /db_xref="MGI:MGI:1345297"
     misc_RNA        1..1982
                     /gene="Slc35a2"
                     /gene_synonym="Had-1; Had1; Sfc8; Ugalt; UGT"
                     /product="solute carrier family 35 (UDP-galactose
                     transporter), member A2, transcript variant 11"
                     /db_xref="GeneID:22232"
                     /db_xref="MGI:MGI:1345297"
     exon            1..101
                     /gene="Slc35a2"
                     /gene_synonym="Had-1; Had1; Sfc8; Ugalt; UGT"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    11..1183
                     /gene="Slc35a2"
                     /gene_synonym="Had-1; Had1; Sfc8; Ugalt; UGT"
                     /inference="COORDINATES:
                     alignment:Blast2seq::RefSeq|NM_001083937.1"
                     /note="primary ORF has stop codon >50 nucleotides from the
                     terminal splice site; nonsense-mediated decay (NMD)
                     candidate"
     exon            102..284
                     /gene="Slc35a2"
                     /gene_synonym="Had-1; Had1; Sfc8; Ugalt; UGT"
                     /inference="alignment:Splign:2.1.0"
     exon            285..436
                     /gene="Slc35a2"
                     /gene_synonym="Had-1; Had1; Sfc8; Ugalt; UGT"
                     /inference="alignment:Splign:2.1.0"
     exon            437..1712
                     /gene="Slc35a2"
                     /gene_synonym="Had-1; Had1; Sfc8; Ugalt; UGT"
                     /inference="alignment:Splign:2.1.0"
     exon            1713..1982
                     /gene="Slc35a2"
                     /gene_synonym="Had-1; Had1; Sfc8; Ugalt; UGT"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

agatgccaacatggcagcggttggggttggtggatctaccgctgcggccggggctggggctgtgtcctcgggcgcgttggaacctgggtccactacagcggctcaccggcgcctcaagtatatatccttagctgtgctggtggtccagaatgcctccctcatcctcagcatccgctacgctcgcacactgcctggggaccgcttctttgccaccactgctgtggtcatggctgaagtgctcaaaggtctcacctgtctcctgctgctcttcgcacaaaagaggggtaatgtgaagcacctggtcctcttcctccatgaggctgtcctggtccaatatgtggacacactcaagcttgcggtgccctctctcatctataccttgcagaataacctccagtatgttgccatcagcaacctgccagctgccactttccaggtgacatatcagctgaagatcctgactacagcgctcttctctgtgctcatgttgaatcgcagcctctcacgcctgcagtgggcctctctgctgctgctcttcactggtgtcgccattgtccaggcacagcaagctggtgggagtggcccacggccactggatcagaacccgggggcgggcttagcggcagttgtggcctcctgtctctcctcaggcttcgctggggtctactttgagaagatcctcaaaggcagctcaggttctgtgtggcttcgtaacctacagctcggcctctttggcacagcgctgggcctggtggggctctggtgggctgagggcaccgccgtggccagtcaaggcttcttctttgggtacacacctgctgtctggggtgtagtactaaaccaagcctttggtgggcttctggtggctgttgttgtcaagtatgctgacaacatcctcaagggctttgccacctccctgtctattgtgctgtccactgttgcctccattcgcctctttggcttccacctggacccattatttgccctgggcgctgggctcgtcattggtgctgtctacctctacagccttccccgaggtgcagtcaaagccatagcctcggcctcggcctctgggccctgcattcaccagcagcctcctgggcagccaccaccaccgcagctgtcttctcgaggagacctcaccacggagccctttctgccaaagtcagtgctggtcaagtgagagctggtggtggttgggggaacagggcagggggttgggttggagggggttgggcttctgcaggtccaaaaagttgttgccagggcctggcttttgtgggttggaggtttattttctcccataattctagagggatatggaactagggctgaatgtcacatgaacgcttcctgatagatggactctcctctcctggaggagctttttagagctgcttcctctgccttgggctaacctctttgggaacagggttggggtactgctattccaggcctttcccccatgaccctgtgctggagatgtcctgtctcgcatgcctgggacagtccctcccagccatcctgcagactggataaaagccctgcagctctccaataacgactaatgactcctcgtggggttcatttcctattgtatgaggtcttctctcctgcaccatcaccctggatcatgacaacagcgtggtctctgctgtggctttggggcagtttccccggtacagagacccttgaagagcaatcagcctgttgttgctcaccaaggtgaaggggtcgtagctgctggacttgaagatgctggcctgtcttcgttctcccttcttgccctggcccaactgggactaaactcttatcagtattaggggtagggtgaggtagacacgggaactccctgtccttaccaacccctgccccacatagggctgacatgactaacctctgttaatgggcccacctctactcctgctatctttacagtatttcttaggtgagtttctgcaaataaaatgttttgcaccttg

//