LOCUS       NR_039765                 83 bp    RNA     linear   PRI 03-SEP-2020
DEFINITION  Homo sapiens microRNA 548an (MIR548AN), microRNA.
ACCESSION   NR_039765
VERSION     NR_039765.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 83)
  AUTHORS   Othumpangat S, Noti JD, Blachere FM and Beezhold DH.
  TITLE     Expression of non-structural-1A binding protein in lung epithelial
            cells is modulated by miRNA-548an on exposure to influenza A virus
  JOURNAL   Virology 447 (1-2), 84-94 (2013)
   PUBMED   24210102
  REMARK    GeneRIF: This study provided evidence that miRNA-548an is involved
            in the regulation of NS1ABP.
REFERENCE   2  (bases 1 to 83)
  AUTHORS   Randall JC, Winkler TW, Kutalik Z, Berndt SI, Jackson AU, Monda KL,
            Kilpelainen TO, Esko T, Magi R, Li S, Workalemahu T, Feitosa MF,
            Croteau-Chonka DC, Day FR, Fall T, Ferreira T, Gustafsson S, Locke
            AE, Mathieson I, Scherag A, Vedantam S, Wood AR, Liang L,
            Steinthorsdottir V, Thorleifsson G, Dermitzakis ET, Dimas AS, Karpe
            F, Min JL, Nicholson G, Clegg DJ, Person T, Krohn JP, Bauer S,
            Buechler C, Eisinger K, Bonnefond A, Froguel P, Hottenga JJ,
            Prokopenko I, Waite LL, Harris TB, Smith AV, Shuldiner AR, McArdle
            WL, Caulfield MJ, Munroe PB, Gronberg H, Chen YD, Li G, Beckmann
            JS, Johnson T, Thorsteinsdottir U, Teder-Laving M, Khaw KT, Wareham
            NJ, Zhao JH, Amin N, Oostra BA, Kraja AT, Province MA, Cupples LA,
            Heard-Costa NL, Kaprio J, Ripatti S, Surakka I, Collins FS,
            Saramies J, Tuomilehto J, Jula A, Salomaa V, Erdmann J,
            Hengstenberg C, Loley C, Schunkert H, Lamina C, Wichmann HE,
            Albrecht E, Gieger C, Hicks AA, Johansson A, Pramstaller PP,
            Kathiresan S, Speliotes EK, Penninx B, Hartikainen AL, Jarvelin MR,
            Gyllensten U, Boomsma DI, Campbell H, Wilson JF, Chanock SJ,
            Farrall M, Goel A, Medina-Gomez C, Rivadeneira F, Estrada K,
            Uitterlinden AG, Hofman A, Zillikens MC, den Heijer M, Kiemeney LA,
            Maschio A, Hall P, Tyrer J, Teumer A, Volzke H, Kovacs P, Tonjes A,
            Mangino M, Spector TD, Hayward C, Rudan I, Hall AS, Samani NJ,
            Attwood AP, Sambrook JG, Hung J, Palmer LJ, Lokki ML, Sinisalo J,
            Boucher G, Huikuri H, Lorentzon M, Ohlsson C, Eklund N, Eriksson
            JG, Barlassina C, Rivolta C, Nolte IM, Snieder H, Van der Klauw MM,
            Van Vliet-Ostaptchouk JV, Gejman PV, Shi J, Jacobs KB, Wang Z,
            Bakker SJ, Mateo Leach I, Navis G, van der Harst P, Martin NG,
            Medland SE, Montgomery GW, Yang J, Chasman DI, Ridker PM, Rose LM,
            Lehtimaki T, Raitakari O, Absher D, Iribarren C, Basart H, Hovingh
            KG, Hypponen E, Power C, Anderson D, Beilby JP, Hui J, Jolley J,
            Sager H, Bornstein SR, Schwarz PE, Kristiansson K, Perola M,
            Lindstrom J, Swift AJ, Uusitupa M, Atalay M, Lakka TA, Rauramaa R,
            Bolton JL, Fowkes G, Fraser RM, Price JF, Fischer K, Krjuta Kov K,
            Metspalu A, Mihailov E, Langenberg C, Luan J, Ong KK, Chines PS,
            Keinanen-Kiukaanniemi SM, Saaristo TE, Edkins S, Franks PW,
            Hallmans G, Shungin D, Morris AD, Palmer CN, Erbel R, Moebus S,
            Nothen MM, Pechlivanis S, Hveem K, Narisu N, Hamsten A, Humphries
            SE, Strawbridge RJ, Tremoli E, Grallert H, Thorand B, Illig T,
            Koenig W, Muller-Nurasyid M, Peters A, Boehm BO, Kleber ME, Marz W,
            Winkelmann BR, Kuusisto J, Laakso M, Arveiler D, Cesana G,
            Kuulasmaa K, Virtamo J, Yarnell JW, Kuh D, Wong A, Lind L, de Faire
            U, Gigante B, Magnusson PK, Pedersen NL, Dedoussis G, Dimitriou M,
            Kolovou G, Kanoni S, Stirrups K, Bonnycastle LL, Njolstad I,
            Wilsgaard T, Ganna A, Rehnberg E, Hingorani A, Kivimaki M, Kumari
            M, Assimes TL, Barroso I, Boehnke M, Borecki IB, Deloukas P, Fox
            CS, Frayling T, Groop LC, Haritunians T, Hunter D, Ingelsson E,
            Kaplan R, Mohlke KL, O'Connell JR, Schlessinger D, Strachan DP,
            Stefansson K, van Duijn CM, Abecasis GR, McCarthy MI, Hirschhorn
            JN, Qi L, Loos RJ, Lindgren CM, North KE and Heid IM.
  CONSRTM   DIAGRAM Consortium; MAGIC Investigators
  TITLE     Sex-stratified genome-wide association studies including 270,000
            individuals show sexual dimorphism in genetic loci for
            anthropometric traits
  JOURNAL   PLoS Genet. 9 (6), e1003500 (2013)
   PUBMED   23754948
REFERENCE   3  (bases 1 to 83)
  AUTHORS   Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY,
            Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP,
            Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI,
            Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Liu Q,
            How T, Grubor V, Gao Y, Patel A, Wu H, Zhu J, Blobe GC, Lipsky PE,
            Chadburn A and Dave SS.
  CONSRTM   Hematologic Malignancies Research Consortium
  TITLE     Deep sequencing of the small RNA transcriptome of normal and
            malignant human B cells identifies hundreds of novel microRNAs
  JOURNAL   Blood 116 (23), e118-e127 (2010)
   PUBMED   20733160
REFERENCE   4  (bases 1 to 83)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res. 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AL590808.6.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-83                AL590808.6         95129-95211
FEATURES             Location/Qualifiers
     source          1..83
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="X"
                     /map="Xq22.3"
     gene            1..83
                     /gene="MIR548AN"
                     /note="microRNA 548an"
                     /db_xref="GeneID:100616144"
                     /db_xref="HGNC:HGNC:41681"
                     /db_xref="miRBase:MI0016907"
     precursor_RNA   1..83
                     /gene="MIR548AN"
                     /product="microRNA 548an"
                     /db_xref="GeneID:100616144"
                     /db_xref="HGNC:HGNC:41681"
                     /db_xref="miRBase:MI0016907"
     exon            1..83
                     /gene="MIR548AN"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="MIR548AN"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2521281651"
     variation       2
                     /gene="MIR548AN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770352111"
     variation       3
                     /gene="MIR548AN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1927461287"
     variation       6
                     /gene="MIR548AN"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1927461397"
     variation       7
                     /gene="MIR548AN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750633541"
     variation       8
                     /gene="MIR548AN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770802542"
     variation       10..22
                     /gene="MIR548AN"
                     /replace=""
                     /replace="ggtgcaaaaggca"
                     /db_xref="dbSNP:763766728"
     variation       10
                     /gene="MIR548AN"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1164456650"
     variation       13
                     /gene="MIR548AN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2521281708"
     ncRNA           15..34
                     /ncRNA_class="miRNA"
                     /gene="MIR548AN"
                     /product="hsa-miR-548an"
                     /db_xref="miRBase:MIMAT0019079"
                     /db_xref="GeneID:100616144"
                     /db_xref="HGNC:HGNC:41681"
                     /db_xref="miRBase:MI0016907"
     variation       16
                     /gene="MIR548AN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2147623980"
     variation       19
                     /gene="MIR548AN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2521281720"
     variation       20
                     /gene="MIR548AN"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1382172478"
     variation       21
                     /gene="MIR548AN"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1419571339"
     variation       22
                     /gene="MIR548AN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253225863"
     variation       26
                     /gene="MIR548AN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1299349049"
     variation       29..33
                     /gene="MIR548AN"
                     /replace="tttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:2521281773"
     variation       29
                     /gene="MIR548AN"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759131879"
     variation       38
                     /gene="MIR548AN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774319701"
     variation       40
                     /gene="MIR548AN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1927462694"
     variation       44
                     /gene="MIR548AN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361824542"
     variation       45
                     /gene="MIR548AN"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2521281815"
     variation       51
                     /gene="MIR548AN"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2521281832"
     variation       56
                     /gene="MIR548AN"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2521281846"
     variation       57
                     /gene="MIR548AN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1927462928"
     variation       58
                     /gene="MIR548AN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775683373"
     variation       59
                     /gene="MIR548AN"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1341261625"
     variation       64
                     /gene="MIR548AN"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1247297052"
     variation       65
                     /gene="MIR548AN"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1267615527"
     variation       72
                     /gene="MIR548AN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1927463804"
     variation       74
                     /gene="MIR548AN"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1927463984"
     variation       77
                     /gene="MIR548AN"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760914245"
     variation       83
                     /gene="MIR548AN"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2521281933"
ORIGIN      

cattaggttggtgcaaaaggcattgtggtttttgcctataaaagtaatggcaaaaaccgcaattccttttgcaccaacctaat

//