LOCUS       NM_214727                848 bp    mRNA    linear   VRT 02-SEP-2023
DEFINITION  Danio rerio brain-specific homeobox (bsx), mRNA.
ACCESSION   NM_214727 XM_687721
VERSION     NM_214727.1
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
REFERENCE   1  (bases 1 to 848)
  AUTHORS   Carstensen MB, Medvetzky A, Weinberger A, Driever W, Gothilf Y and
            Rath MF.
  TITLE     Genetic ablation of the Bsx homeodomain transcription factor in
            zebrafish: Impact on mature pineal gland morphology and circadian
            behavior
  JOURNAL   J Pineal Res 72 (4), e12795 (2022)
   PUBMED   35249239
REFERENCE   2  (bases 1 to 848)
  AUTHORS   Choi JH, Duboue ER, Macurak M, Chanchu JM and Halpern ME.
  TITLE     Specialized neurons in the right habenula mediate response to
            aversive olfactory cues
  JOURNAL   Elife 10, e72345 (2021)
   PUBMED   34878403
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 848)
  AUTHORS   Schredelseker T, Veit F, Dorsky RI and Driever W.
  TITLE     Bsx Is Essential for Differentiation of Multiple Neuromodulatory
            Cell Populations in the Secondary Prosencephalon
  JOURNAL   Front Neurosci 14, 525 (2020)
   PUBMED   32581684
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 848)
  AUTHORS   Schredelseker T and Driever W.
  TITLE     Conserved Genoarchitecture of the Basal Hypothalamus in Zebrafish
            Embryos
  JOURNAL   Front Neuroanat 14, 3 (2020)
   PUBMED   32116574
  REMARK    Publication Status: Online-Only
REFERENCE   5  (bases 1 to 848)
  AUTHORS   Mano H, Asaoka Y, Kojima D and Fukada Y.
  TITLE     Brain-specific homeobox Bsx specifies identity of pineal gland
            between serially homologous photoreceptive organs in zebrafish
  JOURNAL   Commun Biol 2, 364 (2019)
   PUBMED   31602413
  REMARK    GeneRIF: Bsx knock-down impaired the pineal development with
            reduced expression of exorh, the pineal-specific gene responsible
            for the photoreception, whereas it induced ectopic expression of
            rho, a retina-specific gene, in the pineal gland. Bsx remarkably
            transactivated the exorh promoter in combination with Otx5, but not
            with Crx, through its binding to distinct subtypes of PIRE.
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 848)
  AUTHORS   Schredelseker T and Driever W.
  TITLE     Bsx controls pineal complex development
  JOURNAL   Development 145 (13) (2018)
   PUBMED   29945867
  REMARK    GeneRIF: Bsx has a pivotal role in the differentiation of multiple
            cell types in the zebrafish pineal complex.
            Publication Status: Online-Only
REFERENCE   7  (bases 1 to 848)
  AUTHORS   Xie Y, Kaufmann D, Moulton MJ, Panahi S, Gaynes JA, Watters HN,
            Zhou D, Xue HH, Fung CM, Levine EM, Letsou A, Brennan KC and Dorsky
            RI.
  TITLE     Lef1-dependent hypothalamic neurogenesis inhibits anxiety
  JOURNAL   PLoS Biol 15 (8), e2002257 (2017)
   PUBMED   28837622
  REMARK    Publication Status: Online-Only
REFERENCE   8  (bases 1 to 848)
  AUTHORS   Kok FO, Taibi A, Wanner SJ, Xie X, Moravec CE, Love CE, Prince VE,
            Mumm JS and Sirotkin HI.
  TITLE     Zebrafish rest regulates developmental gene expression but not
            neurogenesis
  JOURNAL   Development 139 (20), 3838-3848 (2012)
   PUBMED   22951640
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AY515251.1.
            
            On Jan 26, 2008 this sequence version replaced XM_687721.2.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AY515251.1, EH579801.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA2168447, SAMEA3505370
                                           [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..848
                     /organism="Danio rerio"
                     /mol_type="mRNA"
                     /db_xref="taxon:7955"
                     /chromosome="10"
                     /map="10"
     gene            1..848
                     /gene="bsx"
                     /note="brain-specific homeobox"
                     /db_xref="GeneID:573364"
                     /db_xref="ZFIN:ZDB-GENE-040628-4"
     exon            1..337
                     /gene="bsx"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    13..15
                     /gene="bsx"
                     /note="upstream in-frame stop codon"
     CDS             85..768
                     /gene="bsx"
                     /note="brain-specific homeodomain protein"
                     /codon_start=1
                     /product="brain-specific homeobox protein homolog"
                     /protein_id="NP_999892.1"
                     /db_xref="GeneID:573364"
                     /db_xref="ZFIN:ZDB-GENE-040628-4"
                     /translation="

MNLNYTSPVPQMPTQRSTSFFIEDILLHKPKPLREVFPSPFSNSIASRMPLLEYGYPLMPTPILAPHPHHPLHKPEHHPYFFTSGMQMPALFQHHPELPGKHCRRRKARTVFSDSQLSGLEKRFEIQRYLSTPERVELATALSLSETQVKTWFQNRRMKHKKQLRKTQDDQKTPNDVDRSLENTSESEMHEKNTDGKNGMSPDRYTLDDNEDDVDIEDDICSPEHLL"

     misc_feature    order(400..414,418..420,469..471,487..489,526..528,
                     532..537,544..549,553..561,565..570)
                     /gene="bsx"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    order(406..408,415..417,535..537,544..549,556..558)
                     /gene="bsx"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    409..567
                     /gene="bsx"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:425441"
     misc_feature    553..765
                     /gene="bsx"
                     /note="propagated from UniProtKB/Swiss-Prot (Q6R3Q6.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     exon            338..528
                     /gene="bsx"
                     /inference="alignment:Splign:2.1.0"
     exon            529..848
                     /gene="bsx"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

gaccgaccagagtgattttgtttgcgacgcaggcatcaaaagacgcacggattgttcgcccgagtgtttcaaaaaagttttgagatgaatctgaactacacgtctccggtgccccagatgccgactcaaaggtcaacgtcgttcttcattgaagatattttactacataaacctaaacctttgcgggaggtgtttccctcgcctttttcgaactctattgcctcccggatgcctcttttagagtatggatatccccttatgcctacaccgatactggctcctcatccgcatcatccgttacacaaacctgaacaccatccgtactttttcacctctggaatgcagatgccagcgttatttcagcatcatccggaattaccaggaaagcattgcagacgcagaaaggccagaacagtgttctcagactcacagttatccggactcgagaaaaggttcgagatccagagatatttgtccacacctgagcgcgtggaactggctacagctctcagtctatcggaaacacaggtaaagacgtggtttcaaaaccggaggatgaagcataaaaaacagctgaggaaaacacaagacgaccagaaaaccccgaatgatgtagacagatcgctggagaacacgagcgaaagcgaaatgcacgagaaaaacacagacggtaaaaacggcatgagcccggacagatacacgctggacgacaatgaagatgatgtcgatattgaagatgacatttgctctcctgaacatttactctagtagctattattacactacatcaacaaaaaatgtacatatgaatacaatcttttagataggaaattatatatagttttttt

//