2024-04-19 07:10:43, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_204765 1931 bp mRNA linear VRT 19-SEP-2023 DEFINITION Gallus gallus mesenchyme homeobox 1 (MEOX1), mRNA. ACCESSION NM_204765 VERSION NM_204765.1 KEYWORDS RefSeq. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. REFERENCE 1 (bases 1 to 1931) AUTHORS Tang H, Finn RD and Thomas PD. TITLE TreeGrafter: phylogenetic tree-based annotation of proteins with Gene Ontology terms and other annotations JOURNAL Bioinformatics 35 (3), 518-520 (2019) PUBMED 30032202 REFERENCE 2 (bases 1 to 1931) AUTHORS Burge S, Kelly E, Lonsdale D, Mutowo-Muellenet P, McAnulla C, Mitchell A, Sangrador-Vegas A, Yong SY, Mulder N and Hunter S. TITLE Manual GO annotation of predictive protein signatures: the InterPro approach to GO curation JOURNAL Database (Oxford) 2012, bar068 (2012) PUBMED 22301074 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 1931) AUTHORS Reijntjes S, Stricker S and Mankoo BS. TITLE A comparative analysis of Meox1 and Meox2 in the developing somites and limbs of the chick embryo JOURNAL Int J Dev Biol 51 (8), 753-759 (2007) PUBMED 17939123 REMARK GeneRIF: In the limb bud, Meox1 is co-expressed with Meox2 but neither Meox gene is co-expressed with MyoD, suggesting that these two genes have overlapping and distinct functions in development COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from AF043432.2. ##Evidence-Data-START## Transcript exon combination :: AF043432.2, BU263907.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA103992432, SAMEA103992440 [ECO:0000348] ##Evidence-Data-END## FEATURES Location/Qualifiers source 1..1931 /organism="Gallus gallus" /mol_type="mRNA" /db_xref="taxon:9031" /chromosome="27" /map="27" gene 1..1931 /gene="MEOX1" /gene_synonym="GGMOXR1" /note="mesenchyme homeobox 1" /db_xref="CGNC:810" /db_xref="GeneID:395533" exon 1..644 /gene="MEOX1" /gene_synonym="GGMOXR1" /inference="alignment:Splign:2.1.0" misc_feature 65..67 /gene="MEOX1" /gene_synonym="GGMOXR1" /note="upstream in-frame stop codon" CDS 218..940 /gene="MEOX1" /gene_synonym="GGMOXR1" /note="Mox-1 related protein; mesenchyme homeo box 1" /codon_start=1 /product="homeobox protein MOX-1" /protein_id="NP_990096.1" /db_xref="CGNC:810" /db_xref="GeneID:395533" /translation="
MDPTGGSCMRSPQPPAPLWGCLRGADVPTAPGLGHCPPTPFSFHPKADFAAYSEFSASCLLSAAHCVPPEEQPPPFRPHPEWQQTATEARRLLSPGLALASGDAESPNLVSTAVAVSEDYKVPVNSGMETERKASKRKKEHSESQPSSSKAEGSSRSRKERTAFTKEQLRELEAEFAHHNYLTRLRRYEIAVNLDLTERQVKVWFQNRRMKWKRVKGGQPVSPPEPDAEDADSTTSPSSE"
misc_feature order(689..703,707..709,758..760,776..778,815..817, 821..826,833..838,842..850,854..859) /gene="MEOX1" /gene_synonym="GGMOXR1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature order(695..697,704..706,824..826,833..838,845..847) /gene="MEOX1" /gene_synonym="GGMOXR1" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" misc_feature 698..856 /gene="MEOX1" /gene_synonym="GGMOXR1" /note="Homeobox domain; Region: Homeobox; pfam00046" /db_xref="CDD:425441" exon 645..817 /gene="MEOX1" /gene_synonym="GGMOXR1" /inference="alignment:Splign:2.1.0" exon 818..1931 /gene="MEOX1" /gene_synonym="GGMOXR1" /inference="alignment:Splign:2.1.0" ORIGIN
atcggccttgggaccctcttaggggcgatcgcctccttcacctattcgggacaatgaagacctttagaagagttccccaactaacaaacctccaacctcacaaaccccccagccaaagtgtcgcttagggaggaaatctgggctgtcaaatttggaaacattttcccctccgctcctctcctgctcgaggaacccgagtgacgaacgcgggacgaggatggaccccaccggaggcagctgcatgcgcagcccccaacccccagccccactctgggggtgcctacggggcgctgatgtccccacagccccagggttgggtcactgccccccgacccctttctccttccaccccaaggcggattttgctgcttattctgaattctcagcctcctgcttgctgagcgctgcccactgcgtcccacccgaggagcaaccgccaccgttccgtccccatcctgagtggcagcaaacagcaacagaggcccggagactgctgagcccagggctggcgttggcctctggggatgcagagagccccaacctcgtgagcacagcagtggctgtaagtgaagattacaaagtgccggtaaacagcgggatggagacggagagaaaggcatccaaaaggaaaaaggagcactcagaaagccagccctccagcagcaaggcagaaggcagcagcaggtcgcggaaggagaggacagcgttcaccaaggagcagctgagggagctggaggcagaatttgcccaccacaattacctgacaaggctcaggagatacgagatcgctgtgaacctggacctcaccgagagacaggtcaaagtgtggttccagaatagaaggatgaagtggaagcgcgttaagggggggcaaccagtgtcccctcctgagcccgatgcagaggacgccgactccaccacatcccccagctccgagtagtgccataaagagatgcttggagagggtgtgacactgcagaaggacactgcagctccatagggtggccctgtggggcacggactgagaggtgcgcagtgctggaactggcggagggaaatggaaagcacaaaataagccaaaggagagcaggactttgagctttgtgtgaatggaactgtcttactgccataggggtaccttcaccaaaaggagaaaaagaaaaaagataaaaaccactgtatatatagcaggagtaatgctgtttaggctcccaaatgctcagaaagtatgagttatcagttagaaagggaccagagggtgataacacagctctgttcacctccagcctttccctggtcacttcagctcatccttcacttggacttgggctctgagaatcactgaggttggaatagacctctcagaaccccaagtccaaccccaacccatcccaccgtgcccactgaccatgtctctacgtgccacattccccacatggggaggaacacctccagggatgggaacaccccaccccctgagcagctgtgccaatacccgacctctcttcctgagaacaaatttcacctcacatccaccctcaaagcagcccttaccaaacggcccctgcatcatttccatccttccactctggtttgcttccctatgtgatcatctccacctctgaaggtatccgactgatcccaggacactttaaagccaatttccaagtttaaagagtgcataaaagcagctttctagcataggatgaccacagcacccagacgtgaacgctccttcccttgcacactggtcctctcaacccatacctgtaatatagctaatgattacagtttaggaaagcatagtgtctgttcccatatcttctgtctttttgtttaacgttttctaatgcaactttatcatattttaaacagaactctacactggcatgtcatagaatggctattaaacacgacttttggtattctca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]