2024-03-29 08:03:02, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_204512 954 bp mRNA linear VRT 10-NOV-2023 DEFINITION Gallus gallus brain specific homeobox (BSX), mRNA. ACCESSION NM_204512 VERSION NM_204512.1 KEYWORDS RefSeq. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. REFERENCE 1 (bases 1 to 954) AUTHORS Burge S, Kelly E, Lonsdale D, Mutowo-Muellenet P, McAnulla C, Mitchell A, Sangrador-Vegas A, Yong SY, Mulder N and Hunter S. TITLE Manual GO annotation of predictive protein signatures: the InterPro approach to GO curation JOURNAL Database (Oxford) 2012, bar068 (2012) PUBMED 22301074 REMARK Publication Status: Online-Only COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from AY500594.1. ##Evidence-Data-START## Transcript exon combination :: AY500594.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN03579563, SAMN08016555 [ECO:0000348] ##Evidence-Data-END## FEATURES Location/Qualifiers source 1..954 /organism="Gallus gallus" /mol_type="mRNA" /db_xref="taxon:9031" /chromosome="24" /map="24" gene 1..954 /gene="BSX" /note="brain specific homeobox" /db_xref="CGNC:4913" /db_xref="GeneID:395183" exon 1..343 /gene="BSX" /inference="alignment:Splign:2.1.0" CDS 76..777 /gene="BSX" /note="brain-specific homeodomain protein" /codon_start=1 /product="brain-specific homeobox protein homolog" /protein_id="NP_989843.1" /db_xref="CGNC:4913" /db_xref="GeneID:395183" /translation="
MNLNFTSPVHPVPAPRPTSFFIEDILLHKPKPLREVPPEHFAGSLASRVPLLDYGYPLMPAPALLAPHPHPALHKPEHHHHHPYFLTTSGVPVPALFPHHAHAELPGKHCRRRKARTVFSDSQLSGLEKRFEIQRYLSTPERVELATALSLSETQVKTWFQNRRMKHKKQLRKSQDDPIHEENREQSSPEPELPEPAAAEPRKGPPGPFLLQDPEDEVDILEEGDILAAPHRL"
misc_feature order(412..426,430..432,481..483,499..501,538..540, 544..549,556..561,565..573,577..582) /gene="BSX" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature order(418..420,427..429,547..549,556..561,568..570) /gene="BSX" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" misc_feature 421..579 /gene="BSX" /note="Homeobox domain; Region: Homeobox; pfam00046" /db_xref="CDD:425441" misc_feature 565..729 /gene="BSX" /note="propagated from UniProtKB/Swiss-Prot (Q6RFL5.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" exon 344..540 /gene="BSX" /inference="alignment:Splign:2.1.0" exon 541..954 /gene="BSX" /inference="alignment:Splign:2.1.0" ORIGIN
gccggccgccctttctcctccggcccccagccccgctcgctccgttccccgcaatccgacgcggggccctccgagatgaacctcaacttcacctctccggtacacccggtccccgcgccccgacccacctccttcttcatcgaggacatcctgctgcacaagcccaagcccctgcgggaggtgccccccgagcacttcgccggctccttggcatcccgcgtcccgctcttggactatgggtaccccctgatgcccgccccggcgctgctggctccacacccgcacccggccctgcataaaccggagcaccaccaccaccacccctacttcctcaccacctcgggagtgccggtgccggcgctgttcccgcaccacgctcacgccgagctgcccgggaagcactgccgccgccgcaaggcccgcaccgtcttctccgactctcagctctccggtctggagaagcgcttcgagatccagcgctatctctccacgccagagcgggtggagttggccacggcgctcagcctctccgagacgcaggtgaaaacctggttccagaaccggcggatgaaacacaaaaaacagctgcggaaaagccaggacgaccccatacacgaagagaaccgcgagcagagctcccccgagcccgagctccccgagccggccgcagccgagccccgaaagggcccccccggccccttcttgctgcaggaccccgaggacgaggtggacatcctggaggagggggatatcctcgccgccccacaccgcctttaggagctctcagggcagctttgcgcagccccgcatctctcccccagccccgcgtgctgccggggtgccgaggtttggtgtcggtacggaggggaacaaaacccccgggctcctttcgcccctttggctgcatcccagcgtcaccccaagcctgaactttgcttggaaatccagcggggg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]