ver.2
Home
|
Help
|
Advanced search
  
Previous release (v1)
2025-11-04 11:42:43, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS       NM_001440615             994 bp    mRNA    linear   PRI 22-MAY-2025
DEFINITION  Homo sapiens carboxypeptidase A6 (CPA6), transcript variant 2,
            mRNA.
ACCESSION   NM_001440615 XM_017013647 XM_054360857
VERSION     NM_001440615.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 994)
  AUTHORS   Wang,X., Liu,F., Cui,Z., Li,Z. and Lv,Y.
  TITLE     Carboxypeptidase A6 suppresses the proliferation and invasion of
            colorectal cancer cells and is negatively regulated by miR-96-3p
  JOURNAL   Arch Biochem Biophys 740, 109595 (2023)
   PUBMED   37011707
  REMARK    GeneRIF: Carboxypeptidase A6 suppresses the proliferation and
            invasion of colorectal cancer cells and is negatively regulated by
            miR-96-3p.
REFERENCE   2  (bases 1 to 994)
  AUTHORS   Wang,H., Zhang,M., Zhang,M., Wang,F., Liu,J. and Zhao,Q.
  TITLE     Carboxypeptidase A6 was identified and validated as a novel
            potential biomarker for predicting the occurrence of active
            ulcerative colitis
  JOURNAL   J Cell Mol Med 24 (15), 8803-8813 (2020)
   PUBMED   32570281
  REMARK    GeneRIF: Carboxypeptidase A6 was identified and validated as a
            novel potential biomarker for predicting the occurrence of active
            ulcerative colitis.
REFERENCE   3  (bases 1 to 994)
  AUTHORS   Huang,Q.B., Zhang,H.W. and Liao,Z.B.
  TITLE     Carboxypeptidase A6 Promotes the Proliferation and Migration of
            Hepatocellular Carcinoma by Up-regulating AKT Signaling Pathway
  JOURNAL   Curr Med Sci 39 (5), 727-733 (2019)
   PUBMED   31612389
  REMARK    GeneRIF: CPA6 promotes the proliferation and migration of
            hepatocellular carcinoma by up-regulating AKT signaling pathway.
REFERENCE   4  (bases 1 to 994)
  AUTHORS   Rotroff,D.M., Yee,S.W., Zhou,K., Marvel,S.W., Shah,H.S., Jack,J.R.,
            Havener,T.M., Hedderson,M.M., Kubo,M., Herman,M.A., Gao,H.,
            Mychaleckyi,J.C., McLeod,H.L., Doria,A., Giacomini,K.M.,
            Pearson,E.R., Wagner,M.J., Buse,J.B. and Motsinger-Reif,A.A.
  CONSRTM   MetGen Investigators; ACCORD/ACCORDion Investigators
  TITLE     Genetic Variants in CPA6 and PRPF31 Are Associated With Variation
            in Response to Metformin in Individuals With Type 2 Diabetes
  JOURNAL   Diabetes 67 (7), 1428-1440 (2018)
   PUBMED   29650774
  REMARK    GeneRIF: Common variants in PRPF31 and CPA6 were associated with
            worse and better metformin response, respectively.
REFERENCE   5  (bases 1 to 994)
  AUTHORS   Lyons,P.J. and Fricker,L.D.
  TITLE     Substrate specificity of human carboxypeptidase A6
  JOURNAL   J Biol Chem 285 (49), 38234-38242 (2010)
   PUBMED   20855895
  REMARK    GeneRIF: Substrate specificity of human carboxypeptidase A6
REFERENCE   6  (bases 1 to 994)
  AUTHORS   Talmud,P.J., Drenos,F., Shah,S., Shah,T., Palmen,J., Verzilli,C.,
            Gaunt,T.R., Pallas,J., Lovering,R., Li,K., Casas,J.P., Sofat,R.,
            Kumari,M., Rodriguez,S., Johnson,T., Newhouse,S.J., Dominiczak,A.,
            Samani,N.J., Caulfield,M., Sever,P., Stanton,A., Shields,D.C.,
            Padmanabhan,S., Melander,O., Hastie,C., Delles,C., Ebrahim,S.,
            Marmot,M.G., Smith,G.D., Lawlor,D.A., Munroe,P.B., Day,I.N.,
            Kivimaki,M., Whittaker,J., Humphries,S.E. and Hingorani,A.D.
  CONSRTM   ASCOT investigators; NORDIL investigators; BRIGHT Consortium
  TITLE     Gene-centric association signals for lipids and apolipoproteins
            identified via the HumanCVD BeadChip
  JOURNAL   Am J Hum Genet 85 (5), 628-642 (2009)
   PUBMED   19913121
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   7  (bases 1 to 994)
  AUTHORS   Sharif,S.A., Du,X., Myles,T., Song,J.J., Price,E., Lee,D.M.,
            Goodman,S.B., Nagashima,M., Morser,J., Robinson,W.H. and Leung,L.L.
  TITLE     Thrombin-activatable carboxypeptidase B cleavage of osteopontin
            regulates neutrophil survival and synoviocyte binding in rheumatoid
            arthritis
  JOURNAL   Arthritis Rheum 60 (10), 2902-2912 (2009)
   PUBMED   19790060
  REMARK    GeneRIF: Thrombin activation of osteopontin (OPN) (resulting in
            OPN-R) and its subsequent inactivation by thrombin-activatable
            carboxypeptidase B (generating OPN-L) occurs locally within
            inflamed joints in rheumatoid arthritis.
REFERENCE   8  (bases 1 to 994)
  AUTHORS   Lyons,P.J., Callaway,M.B. and Fricker,L.D.
  TITLE     Characterization of carboxypeptidase A6, an extracellular matrix
            peptidase
  JOURNAL   J Biol Chem 283 (11), 7054-7063 (2008)
   PUBMED   18178555
  REMARK    GeneRIF: CPA6 may have a role in the regulation of neuropeptides in
            the extracellular environment within the olfactory bulb and other
            parts of the brain
REFERENCE   9  (bases 1 to 994)
  AUTHORS   Pizzuti,A., Calabrese,G., Bozzali,M., Telvi,L., Morizio,E.,
            Guida,V., Gatta,V., Stuppia,L., Ion,A., Palka,G. and
            Dallapiccola,B.
  TITLE     A peptidase gene in chromosome 8q is disrupted by a balanced
            translocation in a duane syndrome patient
  JOURNAL   Invest Ophthalmol Vis Sci 43 (12), 3609-3612 (2002)
   PUBMED   12454025
  REMARK    GeneRIF: The CPAH gene was interrupted in a patient with DURS
            carrying a translocation break point in the DURS1 region on
            chromosome 8q13.
REFERENCE   10 (bases 1 to 994)
  AUTHORS   Wei,S., Segura,S., Vendrell,J., Aviles,F.X., Lanoue,E., Day,R.,
            Feng,Y. and Fricker,L.D.
  TITLE     Identification and characterization of three members of the human
            metallocarboxypeptidase gene family
  JOURNAL   J Biol Chem 277 (17), 14954-14964 (2002)
   PUBMED   11836249
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AC022874.8, AC022861.4 and
            AC027006.8.
            
            On or before May 22, 2025 this sequence version replaced
            XM_017013647.2, XM_054360857.1.
            
            Summary: The gene encodes a member of the peptidase M14 family of
            metallocarboxypeptidases. The encoded preproprotein is
            proteolytically processed to generate the mature enzyme, which
            catalyzes the release of large hydrophobic C-terminal amino acids.
            This enzyme has functions ranging from digestion of food to
            selective biosynthesis of neuroendocrine peptides. Mutations in
            this gene may be linked to epilepsy and febrile seizures, and a
            translocation t(6;8)(q26;q13) involving this gene has been
            associated with Duane retraction syndrome. [provided by RefSeq, May
            2016].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR14243140.2938073.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA2155984, SAMN03267758
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-347               AC022874.8         126773-127119
            348-423             AC022861.4         88337-88412
            424-548             AC027006.8         49780-49904         c
            549-663             AC027006.8         43398-43512         c
            664-765             AC027006.8         41374-41475         c
            766-867             AC027006.8         38644-38745         c
            868-994             AC027006.8         37531-37657         c
FEATURES             Location/Qualifiers
     source          1..994
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="8"
                     /map="8q13.2"
     gene            1..994
                     /gene="CPA6"
                     /gene_synonym="CPAH; ETL5; FEB11"
                     /note="carboxypeptidase A6"
                     /db_xref="GeneID:57094"
                     /db_xref="HGNC:HGNC:17245"
                     /db_xref="MIM:609562"
     exon            1..347
                     /gene="CPA6"
                     /gene_synonym="CPAH; ETL5; FEB11"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    199..201
                     /gene="CPA6"
                     /gene_synonym="CPAH; ETL5; FEB11"
                     /note="upstream in-frame stop codon"
     CDS             232..975
                     /gene="CPA6"
                     /gene_synonym="CPAH; ETL5; FEB11"
                     /EC_number="3.4.17.1"
                     /note="isoform 2 precursor is encoded by transcript
                     variant 2; carboxypeptidase B"
                     /codon_start=1
                     /product="carboxypeptidase A6 isoform 2 precursor"
                     /protein_id="NP_001427544.1"
                     /db_xref="GeneID:57094"
                     /db_xref="HGNC:HGNC:17245"
                     /db_xref="MIM:609562"
                     /translation="
MKCLGKRRGQAAAFLPLCWLFLKILQPGHSHLYNNRYAGDKVIRFIPKTEEEAYALKKISYQLKVDLWQPSSISYVSEGTVTDVHIPQNGSRALLAFLQEANIQYKVLIEDLQKTLEKGSSLHTQRNRRSLSGYNYEVYHSLEEIQNWMHHLNKTHSGLIHMFSIGRSYEGRSLFILKLGRRSRLKRAVWIDCGIHAREWIGPAFCQWFVKEVLENTAHKCQECTKFTKYLCHYQNHKSMLNLVSIE"
     sig_peptide     232..321
                     /gene="CPA6"
                     /gene_synonym="CPAH; ETL5; FEB11"
                     /inference="COORDINATES: ab initio prediction:SignalP:6.0"
     misc_feature    496..498
                     /gene="CPA6"
                     /gene_synonym="CPAH; ETL5; FEB11"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q8N4T0.2); glycosylation site"
     misc_feature    688..690
                     /gene="CPA6"
                     /gene_synonym="CPAH; ETL5; FEB11"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q8N4T0.2); glycosylation site"
     exon            348..423
                     /gene="CPA6"
                     /gene_synonym="CPAH; ETL5; FEB11"
                     /inference="alignment:Splign:2.1.0"
     exon            424..548
                     /gene="CPA6"
                     /gene_synonym="CPAH; ETL5; FEB11"
                     /inference="alignment:Splign:2.1.0"
     exon            549..663
                     /gene="CPA6"
                     /gene_synonym="CPAH; ETL5; FEB11"
                     /inference="alignment:Splign:2.1.0"
     exon            664..765
                     /gene="CPA6"
                     /gene_synonym="CPAH; ETL5; FEB11"
                     /inference="alignment:Splign:2.1.0"
     exon            766..867
                     /gene="CPA6"
                     /gene_synonym="CPAH; ETL5; FEB11"
                     /inference="alignment:Splign:2.1.0"
     exon            868..994
                     /gene="CPA6"
                     /gene_synonym="CPAH; ETL5; FEB11"
                     /inference="alignment:Splign:2.1.0"
     regulatory      974..979
                     /regulatory_class="polyA_signal_sequence"
                     /gene="CPA6"
                     /gene_synonym="CPAH; ETL5; FEB11"
                     /note="hexamer: AATAAA"
     polyA_site      994
                     /gene="CPA6"
                     /gene_synonym="CPAH; ETL5; FEB11"
                     /note="major polyA site"
ORIGIN      
gctgctgctgcttgtcccaagaccaagtcgtaatagcaacttcccttcctcagctgcctgaactttttttttcccttgtagctggagagaagtgtcacattttgctcactctcaaccttcctcgcccacccccttcccggagaacctgtgcggtgtgtagagggtgctgtgagccacctccagcctcgggtggctgcttaagtaactttcaactcctctcttcttaacactatgaagtgtctcgggaagcgcaggggccaggcagctgctttcctgcctctttgctggctctttttgaagattctgcaaccggggcacagccacctttataacaaccgctatgctggtgataaagtgataagatttattcccaaaacagaagaggaagcatatgcactgaagaaaatatcctatcaacttaaggtggacctgtggcagcccagcagtatctcctatgtatcagagggaacagttactgatgtccatatcccccaaaatggttcccgagccctgttagccttcttacaggaagccaacatccagtacaaggtcctcatagaagatcttcagaaaacactggagaagggaagcagcttgcacacccagagaaaccgaagatccctctctggatataattatgaagtttatcactccttagaagaaattcaaaattggatgcatcatctgaataaaactcactcaggcctcattcacatgttctctattggaagatcatatgagggaagatctctttttattttaaagctgggcagacgatcacgactcaaaagagctgtttggatagactgtggtattcatgcaagagaatggattggtcctgccttttgtcagtggtttgtaaaagaagtcctagaaaacacagctcacaaatgtcaagaatgtactaaatttacaaaatatctctgccactaccaaaaccacaaaagtatgcttaatcttgtaagtattgagtaataaaattttctaaacattc
//
by
@meso_cacase at 
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]