2025-08-18 18:50:58, GGRNA.v2 : RefSeq release 230 (May, 2025)
LOCUS NM_001437562 4534 bp mRNA linear PRI 04-APR-2025 DEFINITION Homo sapiens semaphorin 5B (SEMA5B), transcript variant 9, mRNA. ACCESSION NM_001437562 XM_047448355 XM_054346927 VERSION NM_001437562.1 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 4534) AUTHORS Maki-Nevala,S., Sarhadi,V.K., Knuuttila,A., Scheinin,I., Ellonen,P., Lagstrom,S., Ronty,M., Kettunen,E., Husgafvel-Pursiainen,K., Wolff,H. and Knuutila,S. TITLE Driver Gene and Novel Mutations in Asbestos-Exposed Lung Adenocarcinoma and Malignant Mesothelioma Detected by Exome Sequencing JOURNAL Lung 194 (1), 125-135 (2016) PUBMED 26463840 REMARK GeneRIF: SEMA5B could possibly serve as a candidate gene for alterations associated with asbestos exposure. REFERENCE 2 (bases 1 to 4534) AUTHORS Wu,C., Hu,Z., He,Z., Jia,W., Wang,F., Zhou,Y., Liu,Z., Zhan,Q., Liu,Y., Yu,D., Zhai,K., Chang,J., Qiao,Y., Jin,G., Liu,Z., Shen,Y., Guo,C., Fu,J., Miao,X., Tan,W., Shen,H., Ke,Y., Zeng,Y., Wu,T. and Lin,D. TITLE Genome-wide association study identifies three new susceptibility loci for esophageal squamous-cell carcinoma in Chinese populations JOURNAL Nat Genet 43 (7), 679-684 (2011) PUBMED 21642993 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 4534) AUTHORS Bailey,S.D., Xie,C., Do,R., Montpetit,A., Diaz,R., Mohan,V., Keavney,B., Yusuf,S., Gerstein,H.C., Engert,J.C. and Anand,S. CONSRTM DREAM investigators TITLE Variation at the NFATC2 locus increases the risk of thiazolidinedione-induced edema in the Diabetes REduction Assessment with ramipril and rosiglitazone Medication (DREAM) study JOURNAL Diabetes Care 33 (10), 2250-2253 (2010) PUBMED 20628086 REMARK GeneRIF: Observational study of gene-disease association, gene-environment interaction, and pharmacogenomic / toxicogenomic. (HuGE Navigator) REFERENCE 4 (bases 1 to 4534) AUTHORS Talmud,P.J., Drenos,F., Shah,S., Shah,T., Palmen,J., Verzilli,C., Gaunt,T.R., Pallas,J., Lovering,R., Li,K., Casas,J.P., Sofat,R., Kumari,M., Rodriguez,S., Johnson,T., Newhouse,S.J., Dominiczak,A., Samani,N.J., Caulfield,M., Sever,P., Stanton,A., Shields,D.C., Padmanabhan,S., Melander,O., Hastie,C., Delles,C., Ebrahim,S., Marmot,M.G., Smith,G.D., Lawlor,D.A., Munroe,P.B., Day,I.N., Kivimaki,M., Whittaker,J., Humphries,S.E. and Hingorani,A.D. CONSRTM ASCOT investigators; NORDIL investigators; BRIGHT Consortium TITLE Gene-centric association signals for lipids and apolipoproteins identified via the HumanCVD BeadChip JOURNAL Am J Hum Genet 85 (5), 628-642 (2009) PUBMED 19913121 REMARK GeneRIF: Observational study of gene-disease association. (HuGE Navigator) REFERENCE 5 (bases 1 to 4534) AUTHORS O'Connor,T.P., Cockburn,K., Wang,W., Tapia,L., Currie,E. and Bamji,S.X. TITLE Semaphorin 5B mediates synapse elimination in hippocampal neurons JOURNAL Neural Dev 4, 18 (2009) PUBMED 19463192 REMARK GeneRIF: Sema5B regulates the development and maintenance of synapse size and number in hippocampal neurons. Publication Status: Online-Only REFERENCE 6 (bases 1 to 4534) AUTHORS Clark,H.F., Gurney,A.L., Abaya,E., Baker,K., Baldwin,D., Brush,J., Chen,J., Chow,B., Chui,C., Crowley,C., Currell,B., Deuel,B., Dowd,P., Eaton,D., Foster,J., Grimaldi,C., Gu,Q., Hass,P.E., Heldens,S., Huang,A., Kim,H.S., Klimowski,L., Jin,Y., Johnson,S., Lee,J., Lewis,L., Liao,D., Mark,M., Robbie,E., Sanchez,C., Schoenfeld,J., Seshagiri,S., Simmons,L., Singh,J., Smith,V., Stinson,J., Vagts,A., Vandlen,R., Watanabe,C., Wieand,D., Woods,K., Xie,M.H., Yansura,D., Yi,S., Yu,G., Yuan,J., Zhang,M., Zhang,Z., Goddard,A., Wood,W.I., Godowski,P. and Gray,A. TITLE The secreted protein discovery initiative (SPDI), a large-scale effort to identify novel human secreted and transmembrane proteins: a bioinformatics assessment JOURNAL Genome Res 13 (10), 2265-2270 (2003) PUBMED 12975309 REMARK Erratum:[Genome Res. 2003 Dec;13(12):2759] REFERENCE 7 (bases 1 to 4534) AUTHORS Adams,R.H., Betz,H. and Puschel,A.W. TITLE A novel class of murine semaphorins with homology to thrombospondin is differentially expressed during early embryogenesis JOURNAL Mech Dev 57 (1), 33-45 (1996) PUBMED 8817451 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AC083797.16 and AC078794.13. On or before Apr 4, 2025 this sequence version replaced XM_047448355.1, XM_054346927.1. Summary: This gene encodes a member of the semaphorin protein family which regulates axon growth during development of the nervous system. The encoded protein has a characteristic Sema domain near the N-terminus, through which semaphorins bind to plexin, and five thrombospondin type 1 repeats in the C-terminal region of the protein. The protein product may be cleaved and exist as a secreted molecule (PMID: 19463192). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]. ##Evidence-Data-START## Transcript exon combination :: SRR14038191.163344.1, SRR18074967.2237476.1 [ECO:0000332] RNAseq introns :: mixed sample support SAMEA1965299, SAMEA1966682 [ECO:0006172] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-300 AC083797.16 147427-147726 301-504 AC078794.13 3032-3235 505-604 AC078794.13 8206-8305 605-650 AC078794.13 12271-12316 651-713 AC078794.13 22683-22745 714-812 AC078794.13 23126-23224 813-1026 AC078794.13 23738-23951 1027-1312 AC078794.13 25064-25349 1313-1448 AC078794.13 27989-28124 1449-1656 AC078794.13 29294-29501 1657-1864 AC078794.13 29619-29826 1865-1982 AC078794.13 35851-35968 1983-2164 AC078794.13 36120-36301 2165-2308 AC078794.13 37740-37883 2309-2456 AC078794.13 38060-38207 2457-2682 AC078794.13 38317-38542 2683-2901 AC078794.13 38680-38898 2902-3072 AC078794.13 39399-39569 3073-3222 AC078794.13 39672-39821 3223-3428 AC078794.13 40696-40901 3429-4534 AC078794.13 41440-42545 FEATURES Location/Qualifiers source 1..4534 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="3" /map="3q21.1" gene 1..4534 /gene="SEMA5B" /gene_synonym="SEMAG; SemG" /note="semaphorin 5B" /db_xref="GeneID:54437" /db_xref="HGNC:HGNC:10737" /db_xref="MIM:609298" exon 1..300 /gene="SEMA5B" /gene_synonym="SEMAG; SemG" /inference="alignment:Splign:2.1.0" exon 301..504 /gene="SEMA5B" /gene_synonym="SEMAG; SemG" /inference="alignment:Splign:2.1.0" CDS 351..3587 /gene="SEMA5B" /gene_synonym="SEMAG; SemG" /note="isoform 7 precursor is encoded by transcript variant 9; sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B" /codon_start=1 /product="semaphorin-5B isoform 7 precursor" /protein_id="NP_001424491.1" /db_xref="GeneID:54437" /db_xref="HGNC:HGNC:10737" /db_xref="MIM:609298" /translation="
MVLAGPLAVSLLLPSLTLLVSHLSSSQDVSSEPSSEQQLCALSKHPTVAFEDLQPWVSNFTYPGARDFSQLALDPSGNQLIVGARNYLFRLSLANVSLLQATEWASSEDTRRSCQSKGKTEEECQNYVRVLIVAGRKVFMCGTNAFSPMCTSRQVGNLSRTIEKINGVARCPYDPRHNSTAVISSQGELYAATVIDFSGRDPAIYRSLGSGPPLRTAQYNSKWLNEPNFVAAYDIGLFAYFFLRENAVEHDCGRTVYSRVARVCKNDVGGRFLLEDTWTTFMKARLNCSRPGEVPFYYNELQSAFHLPEQDLIYGVFTTNVNSIAASAVCAFNLSAISQAFNGPFRYQENPRAAWLPIANPIPNFQCGTLPETGPNENLTERSLQDAQRLFLMSEAVQPVTPEPCVTQDSVRFSHLVVDLVQAKDTLYHVLYIGTESGTILKALSTASRSLHGCYLEELHVLPPGRREPLRSLRILHSARALFVGLRDGVLRVPLERCAAYRSQGACLGARDPYCGWDGKQQRCSTLEDSSNMSLWTQNITACPVRNVTRDGGFGPWSPWQPCEHLDGDNSGSCLCRARSCDSPRPRCGGLDCLGPAIHIANCSRNGAWTPWSSWALCSTSCGIGFQVRQRSCSNPAPRHGGRICVGKSREERFCNENTPCPVPIFWASWGSWSKCSSNCGGGMQSRRRACENGNSCLGCGVEFKTCNPEGCPEVRRNTPWTPWLPVNVTQGGARQEQRFRFTCRAPLADPHGLQFGRRRTETRTCPADGSGSCDTDALVEVLLRSGSTSPHTVSGGWAAWGPWSSCSRDCELGFRVRKRTCTNPEPRNGGLPCVGDAAEYQDCNPQACPVRGAWSCWTSWSPCSASCGGGHYQRTRSCTSPAPSPGEDICLGLHTEEALCATQACPEGWSPWSEWSKCTDDGAQSRSRHCEELLPGSSACAGNSSQSRPCPYSEIPGFNLIHLVATGISCFLGSGLLTLAVYLSCQHCQRQSQESTLVHPATPNHLHYKGGGTPKNEKYTPMEFKTLNKNNLIPDDRANFYPLQQTNVYTTTYYPSPLNKHSFRPEASPGQRCFPNS"
sig_peptide 351..428 /gene="SEMA5B" /gene_synonym="SEMAG; SemG" /inference="COORDINATES: ab initio prediction:SignalP:6.0" exon 505..604 /gene="SEMA5B" /gene_synonym="SEMAG; SemG" /inference="alignment:Splign:2.1.0" exon 605..650 /gene="SEMA5B" /gene_synonym="SEMAG; SemG" /inference="alignment:Splign:2.1.0" exon 651..713 /gene="SEMA5B" /gene_synonym="SEMAG; SemG" /inference="alignment:Splign:2.1.0" exon 714..812 /gene="SEMA5B" /gene_synonym="SEMAG; SemG" /inference="alignment:Splign:2.1.0" exon 813..1026 /gene="SEMA5B" /gene_synonym="SEMAG; SemG" /inference="alignment:Splign:2.1.0" exon 1027..1312 /gene="SEMA5B" /gene_synonym="SEMAG; SemG" /inference="alignment:Splign:2.1.0" exon 1313..1448 /gene="SEMA5B" /gene_synonym="SEMAG; SemG" /inference="alignment:Splign:2.1.0" exon 1449..1656 /gene="SEMA5B" /gene_synonym="SEMAG; SemG" /inference="alignment:Splign:2.1.0" exon 1657..1864 /gene="SEMA5B" /gene_synonym="SEMAG; SemG" /inference="alignment:Splign:2.1.0" exon 1865..1982 /gene="SEMA5B" /gene_synonym="SEMAG; SemG" /inference="alignment:Splign:2.1.0" exon 1983..2164 /gene="SEMA5B" /gene_synonym="SEMAG; SemG" /inference="alignment:Splign:2.1.0" exon 2165..2308 /gene="SEMA5B" /gene_synonym="SEMAG; SemG" /inference="alignment:Splign:2.1.0" exon 2309..2456 /gene="SEMA5B" /gene_synonym="SEMAG; SemG" /inference="alignment:Splign:2.1.0" exon 2457..2682 /gene="SEMA5B" /gene_synonym="SEMAG; SemG" /inference="alignment:Splign:2.1.0" exon 2683..2901 /gene="SEMA5B" /gene_synonym="SEMAG; SemG" /inference="alignment:Splign:2.1.0" exon 2902..3072 /gene="SEMA5B" /gene_synonym="SEMAG; SemG" /inference="alignment:Splign:2.1.0" exon 3073..3222 /gene="SEMA5B" /gene_synonym="SEMAG; SemG" /inference="alignment:Splign:2.1.0" exon 3223..3428 /gene="SEMA5B" /gene_synonym="SEMAG; SemG" /inference="alignment:Splign:2.1.0" exon 3429..4534 /gene="SEMA5B" /gene_synonym="SEMAG; SemG" /inference="alignment:Splign:2.1.0" regulatory 4515..4520 /regulatory_class="polyA_signal_sequence" /gene="SEMA5B" /gene_synonym="SEMAG; SemG" /note="hexamer: ATTAAA" polyA_site 4534 /gene="SEMA5B" /gene_synonym="SEMAG; SemG" /note="major polyA site" ORIGIN
ctccctgctctctccgagcgccgggtcgggagctagttggagcgcgggggttggtgccagagcccagctccgccgagccgggcgggtcggcagcgcatccagcggctgctgggagcccgagcgcagcgggcgcgggcccgggtggggactgcaccggagcgctgagagctggaggccgttcctgcgcggccgccccattcccagaccggccgccagcccatctggttagctcccgccgctccgcgccgcccgggagtcgggagccgcggggaaccgggcacctgcacccgcctctgggaggtcttctcccctgtctgcctcccggagctaggactgcagaggggcctatcatggtgcttgcaggccccctggctgtctcgctgttgctgcccagcctcacactgctggtgtcccacctctccagctcccaggatgtctccagtgagcccagcagtgagcagcagctgtgcgcccttagcaagcaccccaccgtggcctttgaagacctgcagccgtgggtctctaacttcacctaccctggagcccgggatttctcccagctggctttggacccctccgggaaccagctcatcgtgggagccaggaactacctcttcagactcagccttgccaatgtctctcttcttcaggccacagagtgggcctccagtgaggacacgcgccgctcctgccaaagcaaagggaagactgaggaggagtgtcagaactacgtgcgagtcctgatcgtcgccggccggaaggtgttcatgtgtggaaccaatgccttttcccccatgtgcaccagcagacaggtggggaacctcagccggactattgagaagatcaatggtgtggcccgctgcccctatgacccacgccacaactccacagctgtcatctcctcccagggggagctctatgcagccacggtcatcgacttctcaggtcgggaccctgccatctaccgcagcctgggcagtgggccaccgcttcgcactgcccaatataactccaagtggcttaatgagccaaacttcgtggcagcctatgatattgggctgtttgcatacttcttcctgcgggagaacgcagtggagcacgactgtggacgcaccgtgtactctcgcgtggcccgcgtgtgcaagaatgacgtggggggccgattcctgctggaggacacatggaccacattcatgaaggcccggctcaactgctcccgcccgggcgaggtccccttctactataacgagctgcagagtgccttccacttgccggagcaggacctcatctatggagttttcacaaccaacgtaaacagcatcgcggcttctgctgtctgcgccttcaacctcagtgctatctcccaggctttcaatggcccatttcgctaccaggagaaccccagggctgcctggctccccatagccaaccccatccccaatttccagtgtggcaccctgcctgagaccggtcccaacgagaacctgacggagcgcagcctgcaggacgcgcagcgcctcttcctgatgagcgaggccgtgcagccggtgacacccgagccctgtgtcacccaggacagcgtgcgcttctcacacctcgtggtggacctggtgcaggctaaagacacgctctaccatgtactctacattggcaccgagtcgggcaccatcctgaaggcgctgtccacggcgagccgcagcctccacggctgctacctggaggagctgcacgtgctgccccccgggcgccgcgagcccctgcgcagcctgcgcatcctgcacagcgcccgcgcgctcttcgtggggctgagagacggcgtcctgcgggtcccactggagaggtgcgccgcctaccgcagccagggggcatgcctgggggcccgggacccgtactgtggctgggacgggaagcagcaacgttgcagcacactcgaggacagctccaacatgagcctctggacccagaacatcaccgcctgtcctgtgcggaatgtgacacgggatgggggcttcggcccatggtcaccatggcaaccatgtgagcacttggatggggacaactcaggctcttgcctgtgtcgagctcgatcctgtgattcccctcgaccccgctgtgggggccttgactgcctggggccagccatccacatcgccaactgctccaggaatggggcgtggaccccgtggtcatcgtgggcgctgtgcagcacgtcctgtggcatcggcttccaggtccgccagcgaagttgcagcaaccctgctccccgccacgggggccgcatctgcgtgggcaagagccgggaggaacggttctgtaatgagaacacgccttgcccggtgcccatcttctgggcttcctggggctcctggagcaagtgcagcagcaactgtggagggggcatgcagtcgcggcgtcgggcctgcgagaacggcaactcctgcctgggctgcggcgtggagttcaagacgtgcaaccccgagggctgccccgaagtgcggcgcaacaccccctggacgccgtggctgcccgtgaacgtgacgcagggcggggcacggcaggagcagcggttccgcttcacctgccgcgcgccccttgcagacccgcacggcctgcagttcggcaggagaaggaccgagacgaggacctgtcccgcggacggctccggctcctgcgacaccgacgccctggtggaggtcctcctgcgcagcgggagcacctccccgcacacggtgagcgggggctgggccgcctggggcccgtggtcgtcctgctcccgggactgcgagctgggcttccgcgtccgcaagagaacgtgcactaacccggagccccgcaacgggggcctgccctgcgtgggcgatgctgccgagtaccaggactgcaacccccaggcttgcccagttcggggtgcttggtcctgctggacctcatggtctccatgctcagcttcctgtggtgggggtcactatcaacgcacccgttcctgcaccagccccgcaccctccccaggtgaggacatctgtctcgggctgcacacggaggaggcactatgtgccacacaggcctgcccagaaggctggtcgccctggtctgagtggagtaagtgcactgacgacggagcccagagccgaagccggcactgtgaggagctcctcccagggtccagcgcctgtgctggaaacagcagccagagccgcccctgcccctacagcgagattcccgggttcaatctcatccacttggtggccacgggcatctcctgcttcttgggctctgggctcctgaccctagcagtgtacctgtcttgccagcactgccagcgtcagtcccaggagtccacactggtccatcctgccacccccaaccatttgcactacaagggcggaggcaccccgaagaatgaaaagtacacacccatggaattcaagaccctgaacaagaataacttgatccctgatgacagagccaacttctacccattgcagcagaccaatgtgtacacgactacttactacccaagccccctgaacaaacacagcttccggcccgaggcctcacctggacaacggtgcttccccaacagctgataccgccgtcctggggacttgggcttcttgccttcataaggcacagagcagatggagatgggacagtggagccagtttggttttctccctctgcactaggccaagaacttgctgccttgcctgtggggggtcccatccggcttcagagagctctggctggcattgaccatgggggaaagggctggtttcaggctgacatatggccgcaggtccagttcagcccaggtctctcatggttatcttccaacccactgtcacgctgacactatgctgccatgcctgggctgtggacctactgggcatttgaggaattggagaatggagatggcaagagggcaggcttttaagtttgggttggagacaacttcctgtggcccccacaagctgagtctggccttctccagctggccccaaaaaaggcctttgctacatcctgattatctctgaaagtaatcaatcaagtggctccagtagctctggattttctgccagggctgggccattgtggtgctgccccagtatgacatgggaccaaggccagcgcaggttatccacctctgcctggaagtctatactctacccagggcatccctctggtcagaggcagtgagtactgggaactggaggctgacctgtgcttagaagtcctttaatctgggctggtacaggcctcagccttgccctcaatgcacgaaaggtggcccaggagagaggatcaatgccataggaggcagaagtctggcctctgtgcctctatggagactatcttccagttgctgctcaacagagttgttggctgagacctgcttgggagtctctgctggcccttcatctgttcaggaacacacacacacacacactcacacacgcacacacaatcacaatttgctacagcaacaaaaaagacattgggctgtggcattattaattaaagatgatatccagtc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]