GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-03 20:07:03, GGRNA.v2 : RefSeq release 228 (Jan, 2025)

LOCUS       NM_001424325            1722 bp    mRNA    linear   PRI 21-NOV-2024
DEFINITION  Homo sapiens cholesin (CHLSN), transcript variant 15, mRNA.
ACCESSION   NM_001424325
VERSION     NM_001424325.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1722)
  AUTHORS   Ryk,A., Marcinkiewicz,A., Chrzanowski,J., Michalak,A.M., Drozdz,I.,
            Burzynski,J., Krejca,M. and Fendler,W.
  TITLE     Cholesin receptor signalling is active in cardiovascular
            system-associated adipose tissue and correlates with SGLT2i
            treatment in patients with diabetes
  JOURNAL   Cardiovasc Diabetol 23 (1), 211 (2024)
   PUBMED   38902687
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 1722)
  AUTHORS   Hu,X., Chen,F., Jia,L., Long,A., Peng,Y., Li,X., Huang,J., Wei,X.,
            Fang,X., Gao,Z., Zhang,M., Liu,X., Chen,Y.G., Wang,Y., Zhang,H. and
            Wang,Y.
  TITLE     A gut-derived hormone regulates cholesterol metabolism
  JOURNAL   Cell 187 (7), 1685-1700 (2024)
   PUBMED   38503280
  REMARK    GeneRIF: A gut-derived hormone regulates cholesterol metabolism.
REFERENCE   3  (bases 1 to 1722)
  AUTHORS   Haenig,C., Atias,N., Taylor,A.K., Mazza,A., Schaefer,M.H., Russ,J.,
            Riechers,S.P., Jain,S., Coughlin,M., Fontaine,J.F., Freibaum,B.D.,
            Brusendorf,L., Zenkner,M., Porras,P., Stroedicke,M., Schnoegl,S.,
            Arnsburg,K., Boeddrich,A., Pigazzini,L., Heutink,P., Taylor,J.P.,
            Kirstein,J., Andrade-Navarro,M.A., Sharan,R. and Wanker,E.E.
  TITLE     Interactome Mapping Provides a Network of Neurodegenerative Disease
            Proteins and Uncovers Widespread Protein Aggregation in Affected
            Brains
  JOURNAL   Cell Rep 32 (7), 108050 (2020)
   PUBMED   32814053
REFERENCE   4  (bases 1 to 1722)
  AUTHORS   Luck,K., Kim,D.K., Lambourne,L., Spirohn,K., Begg,B.E., Bian,W.,
            Brignall,R., Cafarelli,T., Campos-Laborie,F.J., Charloteaux,B.,
            Choi,D., Cote,A.G., Daley,M., Deimling,S., Desbuleux,A., Dricot,A.,
            Gebbia,M., Hardy,M.F., Kishore,N., Knapp,J.J., Kovacs,I.A.,
            Lemmens,I., Mee,M.W., Mellor,J.C., Pollis,C., Pons,C.,
            Richardson,A.D., Schlabach,S., Teeking,B., Yadav,A., Babor,M.,
            Balcha,D., Basha,O., Bowman-Colin,C., Chin,S.F., Choi,S.G.,
            Colabella,C., Coppin,G., D'Amata,C., De Ridder,D., De Rouck,S.,
            Duran-Frigola,M., Ennajdaoui,H., Goebels,F., Goehring,L., Gopal,A.,
            Haddad,G., Hatchi,E., Helmy,M., Jacob,Y., Kassa,Y., Landini,S.,
            Li,R., van Lieshout,N., MacWilliams,A., Markey,D., Paulson,J.N.,
            Rangarajan,S., Rasla,J., Rayhan,A., Rolland,T., San-Miguel,A.,
            Shen,Y., Sheykhkarimli,D., Sheynkman,G.M., Simonovsky,E., Tasan,M.,
            Tejeda,A., Tropepe,V., Twizere,J.C., Wang,Y., Weatheritt,R.J.,
            Weile,J., Xia,Y., Yang,X., Yeger-Lotem,E., Zhong,Q., Aloy,P.,
            Bader,G.D., De Las Rivas,J., Gaudet,S., Hao,T., Rak,J.,
            Tavernier,J., Hill,D.E., Vidal,M., Roth,F.P. and Calderwood,M.A.
  TITLE     A reference map of the human binary protein interactome
  JOURNAL   Nature 580 (7803), 402-408 (2020)
   PUBMED   32296183
REFERENCE   5  (bases 1 to 1722)
  AUTHORS   Meeks,K.A.C., Henneman,P., Venema,A., Addo,J., Bahendeka,S.,
            Burr,T., Danquah,I., Galbete,C., Mannens,M.M.A.M.,
            Mockenhaupt,F.P., Owusu-Dabo,E., Rotimi,C.N., Schulze,M.B.,
            Smeeth,L., Spranger,J., Zafarmand,M.H., Adeyemo,A. and Agyemang,C.
  TITLE     Epigenome-wide association study in whole blood on type 2 diabetes
            among sub-Saharan African individuals: findings from the RODAM
            study
  JOURNAL   Int J Epidemiol 48 (1), 58-70 (2019)
   PUBMED   30107520
  REMARK    GeneRIF: Three ubiquitous methylation loci were consistently and
            strongly associated with type 2 diabetes in Ghanaians: TXNIP,
            C7orf50 and CPT1A
REFERENCE   6  (bases 1 to 1722)
  AUTHORS   Willer,C.J., Schmidt,E.M., Sengupta,S., Peloso,G.M., Gustafsson,S.,
            Kanoni,S., Ganna,A., Chen,J., Buchkovich,M.L., Mora,S.,
            Beckmann,J.S., Bragg-Gresham,J.L., Chang,H.Y., Demirkan,A., Den
            Hertog,H.M., Do,R., Donnelly,L.A., Ehret,G.B., Esko,T.,
            Feitosa,M.F., Ferreira,T., Fischer,K., Fontanillas,P., Fraser,R.M.,
            Freitag,D.F., Gurdasani,D., Heikkila,K., Hypponen,E., Isaacs,A.,
            Jackson,A.U., Johansson,A., Johnson,T., Kaakinen,M., Kettunen,J.,
            Kleber,M.E., Li,X., Luan,J., Lyytikainen,L.P., Magnusson,P.K.E.,
            Mangino,M., Mihailov,E., Montasser,M.E., Muller-Nurasyid,M.,
            Nolte,I.M., O'Connell,J.R., Palmer,C.D., Perola,M., Petersen,A.K.,
            Sanna,S., Saxena,R., Service,S.K., Shah,S., Shungin,D., Sidore,C.,
            Song,C., Strawbridge,R.J., Surakka,I., Tanaka,T., Teslovich,T.M.,
            Thorleifsson,G., Van den Herik,E.G., Voight,B.F., Volcik,K.A.,
            Waite,L.L., Wong,A., Wu,Y., Zhang,W., Absher,D., Asiki,G.,
            Barroso,I., Been,L.F., Bolton,J.L., Bonnycastle,L.L., Brambilla,P.,
            Burnett,M.S., Cesana,G., Dimitriou,M., Doney,A.S.F., Doring,A.,
            Elliott,P., Epstein,S.E., Ingi Eyjolfsson,G., Gigante,B.,
            Goodarzi,M.O., Grallert,H., Gravito,M.L., Groves,C.J., Hallmans,G.,
            Hartikainen,A.L., Hayward,C., Hernandez,D., Hicks,A.A., Holm,H.,
            Hung,Y.J., Illig,T., Jones,M.R., Kaleebu,P., Kastelein,J.J.P.,
            Khaw,K.T., Kim,E., Klopp,N., Komulainen,P., Kumari,M.,
            Langenberg,C., Lehtimaki,T., Lin,S.Y., Lindstrom,J., Loos,R.J.F.,
            Mach,F., McArdle,W.L., Meisinger,C., Mitchell,B.D., Muller,G.,
            Nagaraja,R., Narisu,N., Nieminen,T.V.M., Nsubuga,R.N., Olafsson,I.,
            Ong,K.K., Palotie,A., Papamarkou,T., Pomilla,C., Pouta,A.,
            Rader,D.J., Reilly,M.P., Ridker,P.M., Rivadeneira,F., Rudan,I.,
            Ruokonen,A., Samani,N., Scharnagl,H., Seeley,J., Silander,K.,
            Stancakova,A., Stirrups,K., Swift,A.J., Tiret,L.,
            Uitterlinden,A.G., van Pelt,L.J., Vedantam,S., Wainwright,N.,
            Wijmenga,C., Wild,S.H., Willemsen,G., Wilsgaard,T., Wilson,J.F.,
            Young,E.H., Zhao,J.H., Adair,L.S., Arveiler,D., Assimes,T.L.,
            Bandinelli,S., Bennett,F., Bochud,M., Boehm,B.O., Boomsma,D.I.,
            Borecki,I.B., Bornstein,S.R., Bovet,P., Burnier,M., Campbell,H.,
            Chakravarti,A., Chambers,J.C., Chen,Y.I., Collins,F.S.,
            Cooper,R.S., Danesh,J., Dedoussis,G., de Faire,U., Feranil,A.B.,
            Ferrieres,J., Ferrucci,L., Freimer,N.B., Gieger,C., Groop,L.C.,
            Gudnason,V., Gyllensten,U., Hamsten,A., Harris,T.B., Hingorani,A.,
            Hirschhorn,J.N., Hofman,A., Hovingh,G.K., Hsiung,C.A.,
            Humphries,S.E., Hunt,S.C., Hveem,K., Iribarren,C., Jarvelin,M.R.,
            Jula,A., Kahonen,M., Kaprio,J., Kesaniemi,A., Kivimaki,M.,
            Kooner,J.S., Koudstaal,P.J., Krauss,R.M., Kuh,D., Kuusisto,J.,
            Kyvik,K.O., Laakso,M., Lakka,T.A., Lind,L., Lindgren,C.M.,
            Martin,N.G., Marz,W., McCarthy,M.I., McKenzie,C.A., Meneton,P.,
            Metspalu,A., Moilanen,L., Morris,A.D., Munroe,P.B., Njolstad,I.,
            Pedersen,N.L., Power,C., Pramstaller,P.P., Price,J.F., Psaty,B.M.,
            Quertermous,T., Rauramaa,R., Saleheen,D., Salomaa,V.,
            Sanghera,D.K., Saramies,J., Schwarz,P.E.H., Sheu,W.H.,
            Shuldiner,A.R., Siegbahn,A., Spector,T.D., Stefansson,K.,
            Strachan,D.P., Tayo,B.O., Tremoli,E., Tuomilehto,J., Uusitupa,M.,
            van Duijn,C.M., Vollenweider,P., Wallentin,L., Wareham,N.J.,
            Whitfield,J.B., Wolffenbuttel,B.H.R., Ordovas,J.M., Boerwinkle,E.,
            Palmer,C.N.A., Thorsteinsdottir,U., Chasman,D.I., Rotter,J.I.,
            Franks,P.W., Ripatti,S., Cupples,L.A., Sandhu,M.S., Rich,S.S.,
            Boehnke,M., Deloukas,P., Kathiresan,S., Mohlke,K.L., Ingelsson,E.
            and Abecasis,G.R.
  CONSRTM   Global Lipids Genetics Consortium
  TITLE     Discovery and refinement of loci associated with lipid levels
  JOURNAL   Nat Genet 45 (11), 1274-1283 (2013)
   PUBMED   24097068
REFERENCE   7  (bases 1 to 1722)
  AUTHORS   Castello,A., Fischer,B., Eichelbaum,K., Horos,R., Beckmann,B.M.,
            Strein,C., Davey,N.E., Humphreys,D.T., Preiss,T., Steinmetz,L.M.,
            Krijgsveld,J. and Hentze,M.W.
  TITLE     Insights into RNA biology from an atlas of mammalian mRNA-binding
            proteins
  JOURNAL   Cell 149 (6), 1393-1406 (2012)
   PUBMED   22658674
REFERENCE   8  (bases 1 to 1722)
  AUTHORS   Yashin,A.I., Wu,D., Arbeev,K.G. and Ukraintseva,S.V.
  TITLE     Joint influence of small-effect genetic variants on human longevity
  JOURNAL   Aging (Albany NY) 2 (9), 612-620 (2010)
   PUBMED   20834067
REFERENCE   9  (bases 1 to 1722)
  AUTHORS   Satoh,J., Obayashi,S., Misawa,T., Sumiyoshi,K., Oosumi,K. and
            Tabunoki,H.
  TITLE     Protein microarray analysis identifies human cellular prion protein
            interactors
  JOURNAL   Neuropathol Appl Neurobiol 35 (1), 16-35 (2009)
   PUBMED   18482256
REFERENCE   10 (bases 1 to 1722)
  AUTHORS   Oh,J.H., Yang,J.O., Hahn,Y., Kim,M.R., Byun,S.S., Jeon,Y.J.,
            Kim,J.M., Song,K.S., Noh,S.M., Kim,S., Yoo,H.S., Kim,Y.S. and
            Kim,N.S.
  TITLE     Transcriptome analysis of human gastric cancer
  JOURNAL   Mamm Genome 16 (12), 942-954 (2005)
   PUBMED   16341674
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC091729.4 and AC073957.7.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR14038194.3485593.1,
                                           SRR14478891.1397768.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA2144120 [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-59                AC091729.4         65045-65103         c
            60-189              AC091729.4         54113-54242         c
            190-383             AC073957.7         131010-131203       c
            384-465             AC073957.7         121530-121611       c
            466-624             AC073957.7         118706-118864       c
            625-1722            AC073957.7         99024-100121        c
FEATURES             Location/Qualifiers
     source          1..1722
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="7"
                     /map="7p22.3"
     gene            1..1722
                     /gene="CHLSN"
                     /gene_synonym="C7orf50; YCR016W"
                     /note="cholesin"
                     /db_xref="GeneID:84310"
                     /db_xref="HGNC:HGNC:22421"
     exon            1..59
                     /gene="CHLSN"
                     /gene_synonym="C7orf50; YCR016W"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    28..30
                     /gene="CHLSN"
                     /gene_synonym="C7orf50; YCR016W"
                     /note="upstream in-frame stop codon"
     exon            60..189
                     /gene="CHLSN"
                     /gene_synonym="C7orf50; YCR016W"
                     /inference="alignment:Splign:2.1.0"
     CDS             61..738
                     /gene="CHLSN"
                     /gene_synonym="C7orf50; YCR016W"
                     /note="isoform d is encoded by transcript variant 15;
                     uncharacterized protein C7orf50; protein cholesin"
                     /codon_start=1
                     /product="protein cholesin isoform d"
                     /protein_id="NP_001411254.1"
                     /db_xref="GeneID:84310"
                     /db_xref="HGNC:HGNC:22421"
                     /translation="
MAKQKRKVPEVTEKKNKKLKKASAEGPLLGPEAAPSGEGAGSKGEAVLRPGLDAEPELSPEEQRVLERKLKKERKKEERQRLREAGLVAQHPPARRSGAELALDYLCRWAQKHKNWRFQKTRQTWLLLHMYDSDKVPDEHFSTLLAYLEGLQGRARELTVQKAEALMRELDEEGSDPPLPGRAQRIRQDTCAVDPAAMLWGSPAARRGAHVEGNPGPRNRGQAST"
     misc_feature    61..309
                     /gene="CHLSN"
                     /gene_synonym="C7orf50; YCR016W"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9BRJ6.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    127..129
                     /gene="CHLSN"
                     /gene_synonym="C7orf50; YCR016W"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:18669648; propagated from
                     UniProtKB/Swiss-Prot (Q9BRJ6.1); phosphorylation site"
     misc_feature    235..237
                     /gene="CHLSN"
                     /gene_synonym="C7orf50; YCR016W"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:20068231,
                     ECO:0007744|PubMed:21406692, ECO:0007744|PubMed:23186163;
                     propagated from UniProtKB/Swiss-Prot (Q9BRJ6.1);
                     phosphorylation site"
     misc_feature    349..351
                     /gene="CHLSN"
                     /gene_synonym="C7orf50; YCR016W"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:18669648,
                     ECO:0007744|PubMed:20068231; propagated from
                     UniProtKB/Swiss-Prot (Q9BRJ6.1); phosphorylation site"
     misc_feature    583..585
                     /gene="CHLSN"
                     /gene_synonym="C7orf50; YCR016W"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:21406692,
                     ECO:0007744|PubMed:23186163; propagated from
                     UniProtKB/Swiss-Prot (Q9BRJ6.1); phosphorylation site"
     exon            190..383
                     /gene="CHLSN"
                     /gene_synonym="C7orf50; YCR016W"
                     /inference="alignment:Splign:2.1.0"
     exon            384..465
                     /gene="CHLSN"
                     /gene_synonym="C7orf50; YCR016W"
                     /inference="alignment:Splign:2.1.0"
     exon            466..624
                     /gene="CHLSN"
                     /gene_synonym="C7orf50; YCR016W"
                     /inference="alignment:Splign:2.1.0"
     exon            625..1722
                     /gene="CHLSN"
                     /gene_synonym="C7orf50; YCR016W"
                     /inference="alignment:Splign:2.1.0"
     regulatory      1700..1705
                     /regulatory_class="polyA_signal_sequence"
                     /gene="CHLSN"
                     /gene_synonym="C7orf50; YCR016W"
                     /note="hexamer: AATAAA"
     polyA_site      1722
                     /gene="CHLSN"
                     /gene_synonym="C7orf50; YCR016W"
                     /note="major polyA site"
ORIGIN      
ggcgtccgcgacgcagctgttcacgcttaggtgggcgacgtgggcgcaggtgggcgcaggatggcaaaacagaagagaaaagttcctgaagtgacagagaaaaagaacaaaaagctgaagaaggcgtcagcagaggggccactgctgggccctgaggctgcaccaagtggcgaaggagccggctccaagggcgaagctgtgctcaggcccgggctggacgcagagccagagctgtccccagaggagcagagggtcctggaaaggaagctgaaaaaggaacggaagaaagaggagaggcagcgtctgcgggaggcaggccttgtggcccagcacccgcctgccaggcgctcgggggccgaactggccctggactacctctgcagatgggcccaaaagcacaagaactggaggtttcagaagacgaggcagacgtggctcctgctgcacatgtatgacagtgacaaggttcccgatgagcacttctccaccctgctggcctacctggaggggctgcagggccgggcccgagagctgacggtgcagaaggcggaagccctgatgcgggagctggatgaggagggctctgatccccccctgccggggagggcccagcgcatccgacaggacacctgtgccgtggacccagccgccatgctgtggggaagcccagcagctcgtagaggggcccatgtggaggggaacccaggcccacggaaccgtggccaggcttccacatgacactgagcccacctgcctgccagccacgtgtgccatcgtgagtggatcctccagtccgaagtggagctaacccggcccaggcctcgtggaatgtctccaccaagccctgcccaagtgcaagtgcaagttcacgggtaatgactgctgctaagcttggggtgctttgttatgcagcggcagataacgcgaacacggccacgtaagcttcagcaagggctgtgaccccttgagtctgtttctctgtgtcagatgaggataataagacctacttagctggattcattcatcttcgagctataaacggagcatgtccagcgtgccaggcactgctccaggctctggggatccgggtggaaatacctgcaataccttgattgctggggctcaaacaaggttcgttccctcctctgagcttttccttttttcttgtagacaaggtctcacttttttgcccaggctgcagtgcagtggtgcgatcttggttcactgcagcctcgacctcccagggctcagacgatcctcccacctcagcctctggggtagctgggaccacaggtgtgcgcccctacacctggctaatttttgtattttttatagacgtagggtttcagcatgttgccaaggctggtctcaaactcctgggctcaagtggtccgcccacctcggcttcccagagtgttgggattacaggtgtgagccaccgcccccagccccttccccactttttacaccggtgaactgctcataaaaattctttcctcttctctcccagctaaagatctcatataaagcaataatcatttgccaggtgacagtcaattaaaagccggttgtcacctccaggccacaggtccctcggggctcccagacagagaggcttagggcagccccaacggaggggctgtccttccactgctaagcggctgctgcagtcaagtgagtgagcgcttctttgctgggtaataaaagctcccattgttcaca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]