LOCUS       NM_001424228            1134 bp    mRNA    linear   PRI 22-SEP-2024
DEFINITION  Homo sapiens elongator acetyltransferase complex subunit 6 (ELP6),
            transcript variant 20, mRNA.
ACCESSION   NM_001424228
VERSION     NM_001424228.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1134)
  AUTHORS   Huttlin,E.L., Bruckner,R.J., Navarrete-Perea,J., Cannon,J.R.,
            Baltier,K., Gebreab,F., Gygi,M.P., Thornock,A., Zarraga,G., Tam,S.,
            Szpyt,J., Gassaway,B.M., Panov,A., Parzen,H., Fu,S., Golbazi,A.,
            Maenpaa,E., Stricker,K., Guha Thakurta,S., Zhang,T., Rad,R.,
            Pan,J., Nusinow,D.P., Paulo,J.A., Schweppe,D.K., Vaites,L.P.,
            Harper,J.W. and Gygi,S.P.
  TITLE     Dual proteome-scale networks reveal cell-specific remodeling of the
            human interactome
  JOURNAL   Cell 184 (11), 3022-3040 (2021)
   PUBMED   33961781
REFERENCE   2  (bases 1 to 1134)
  AUTHORS   Kojic,M. and Wainwright,B.
  TITLE     The Many Faces of Elongator in Neurodevelopment and Disease
  JOURNAL   Front Mol Neurosci 9, 115 (2016)
   PUBMED   27847465
  REMARK    Review article
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1134)
  AUTHORS   Arking,D.E., Pulit,S.L., Crotti,L., van der Harst,P., Munroe,P.B.,
            Koopmann,T.T., Sotoodehnia,N., Rossin,E.J., Morley,M., Wang,X.,
            Johnson,A.D., Lundby,A., Gudbjartsson,D.F., Noseworthy,P.A.,
            Eijgelsheim,M., Bradford,Y., Tarasov,K.V., Dorr,M.,
            Muller-Nurasyid,M., Lahtinen,A.M., Nolte,I.M., Smith,A.V.,
            Bis,J.C., Isaacs,A., Newhouse,S.J., Evans,D.S., Post,W.S.,
            Waggott,D., Lyytikainen,L.P., Hicks,A.A., Eisele,L., Ellinghaus,D.,
            Hayward,C., Navarro,P., Ulivi,S., Tanaka,T., Tester,D.J.,
            Chatel,S., Gustafsson,S., Kumari,M., Morris,R.W., Naluai,A.T.,
            Padmanabhan,S., Kluttig,A., Strohmer,B., Panayiotou,A.G.,
            Torres,M., Knoflach,M., Hubacek,J.A., Slowikowski,K.,
            Raychaudhuri,S., Kumar,R.D., Harris,T.B., Launer,L.J.,
            Shuldiner,A.R., Alonso,A., Bader,J.S., Ehret,G., Huang,H.,
            Kao,W.H., Strait,J.B., Macfarlane,P.W., Brown,M., Caulfield,M.J.,
            Samani,N.J., Kronenberg,F., Willeit,J., Smith,J.G., Greiser,K.H.,
            Meyer Zu Schwabedissen,H., Werdan,K., Carella,M., Zelante,L.,
            Heckbert,S.R., Psaty,B.M., Rotter,J.I., Kolcic,I., Polasek,O.,
            Wright,A.F., Griffin,M., Daly,M.J., Arnar,D.O., Holm,H.,
            Thorsteinsdottir,U., Denny,J.C., Roden,D.M., Zuvich,R.L.,
            Emilsson,V., Plump,A.S., Larson,M.G., O'Donnell,C.J., Yin,X.,
            Bobbo,M., D'Adamo,A.P., Iorio,A., Sinagra,G., Carracedo,A.,
            Cummings,S.R., Nalls,M.A., Jula,A., Kontula,K.K., Marjamaa,A.,
            Oikarinen,L., Perola,M., Porthan,K., Erbel,R., Hoffmann,P.,
            Jockel,K.H., Kalsch,H., Nothen,M.M., den Hoed,M., Loos,R.J.,
            Thelle,D.S., Gieger,C., Meitinger,T., Perz,S., Peters,A.,
            Prucha,H., Sinner,M.F., Waldenberger,M., de Boer,R.A., Franke,L.,
            van der Vleuten,P.A., Beckmann,B.M., Martens,E., Bardai,A.,
            Hofman,N., Wilde,A.A., Behr,E.R., Dalageorgou,C., Giudicessi,J.R.,
            Medeiros-Domingo,A., Barc,J., Kyndt,F., Probst,V., Ghidoni,A.,
            Insolia,R., Hamilton,R.M., Scherer,S.W., Brandimarto,J.,
            Margulies,K., Moravec,C.E., del Greco,M. F, Fuchsberger,C.,
            O'Connell,J.R., Lee,W.K., Watt,G.C., Campbell,H., Wild,S.H., El
            Mokhtari,N.E., Frey,N., Asselbergs,F.W., Mateo Leach,I., Navis,G.,
            van den Berg,M.P., van Veldhuisen,D.J., Kellis,M., Krijthe,B.P.,
            Franco,O.H., Hofman,A., Kors,J.A., Uitterlinden,A.G.,
            Witteman,J.C., Kedenko,L., Lamina,C., Oostra,B.A., Abecasis,G.R.,
            Lakatta,E.G., Mulas,A., Orru,M., Schlessinger,D., Uda,M.,
            Markus,M.R., Volker,U., Snieder,H., Spector,T.D., Arnlov,J.,
            Lind,L., Sundstrom,J., Syvanen,A.C., Kivimaki,M., Kahonen,M.,
            Mononen,N., Raitakari,O.T., Viikari,J.S., Adamkova,V., Kiechl,S.,
            Brion,M., Nicolaides,A.N., Paulweber,B., Haerting,J.,
            Dominiczak,A.F., Nyberg,F., Whincup,P.H., Hingorani,A.D.,
            Schott,J.J., Bezzina,C.R., Ingelsson,E., Ferrucci,L., Gasparini,P.,
            Wilson,J.F., Rudan,I., Franke,A., Muhleisen,T.W., Pramstaller,P.P.,
            Lehtimaki,T.J., Paterson,A.D., Parsa,A., Liu,Y., van Duijn,C.M.,
            Siscovick,D.S., Gudnason,V., Jamshidi,Y., Salomaa,V., Felix,S.B.,
            Sanna,S., Ritchie,M.D., Stricker,B.H., Stefansson,K., Boyer,L.A.,
            Cappola,T.P., Olsen,J.V., Lage,K., Schwartz,P.J., Kaab,S.,
            Chakravarti,A., Ackerman,M.J., Pfeufer,A., de Bakker,P.I. and
            Newton-Cheh,C.
  CONSRTM   CARe Consortium; COGENT Consortium; DCCT/EDIC; eMERGE Consortium;
            HRGEN Consortium
  TITLE     Genetic association study of QT interval highlights role for
            calcium signaling pathways in myocardial repolarization
  JOURNAL   Nat Genet 46 (8), 826-836 (2014)
   PUBMED   24952745
REFERENCE   4  (bases 1 to 1134)
  AUTHORS   Wagner,L.A., Wang,S., Wayner,E.A., Christensen,C., Perkins,S.J.,
            Ward,G.W., Weiss,R.B., Dunn,D.M., Redd,M.J., Spangrude,G.J. and
            Gleich,G.J.
  TITLE     Developing and mature human granulocytes express ELP 6 in the
            cytoplasm
  JOURNAL   Hum Antibodies 22 (1-2), 21-29 (2013)
   PUBMED   24284306
  REMARK    GeneRIF: ELP6 is expressed intracellularly in developing and mature
            granulocytes and monocytes but not in lymphocytes and erythrocytes.
REFERENCE   5  (bases 1 to 1134)
  AUTHORS   Close,P., Gillard,M., Ladang,A., Jiang,Z., Papuga,J., Hawkes,N.,
            Nguyen,L., Chapelle,J.P., Bouillenne,F., Svejstrup,J., Fillet,M.
            and Chariot,A.
  TITLE     DERP6 (ELP5) and C3ORF75 (ELP6) regulate tumorigenicity and
            migration of melanoma cells as subunits of Elongator
  JOURNAL   J Biol Chem 287 (39), 32535-32545 (2012)
   PUBMED   22854966
  REMARK    GeneRIF: data identify DERP6/ELP5 and C3ORF75/ELP6 as key players
            for migration, invasion and tumorigenicity of melanoma cells, as
            integral subunits of Elongator.
REFERENCE   6  (bases 1 to 1134)
  AUTHORS   Bolukbasi,E., Vass,S., Cobbe,N., Nelson,B., Simossis,V.,
            Dunbar,D.R. and Heck,M.M.
  TITLE     Drosophila poly suggests a novel role for the Elongator complex in
            insulin receptor-target of rapamycin signalling
  JOURNAL   Open Biol 2 (1), 110031 (2012)
   PUBMED   22645656
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC099778.2.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR18074967.3148421.1,
                                           SRR14327317.746266.1 [ECO:0000332]
            RNAseq introns              :: mixed sample support SAMEA1965299,
                                           SAMEA1966682 [ECO:0006172]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-176               AC099778.2         158054-158229       c
            177-255             AC099778.2         155665-155743       c
            256-374             AC099778.2         148847-148965       c
            375-576             AC099778.2         146167-146368       c
            577-1134            AC099778.2         140157-140714       c
FEATURES             Location/Qualifiers
     source          1..1134
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="3"
                     /map="3p21.31"
     gene            1..1134
                     /gene="ELP6"
                     /gene_synonym="C3orf75; TMEM103"
                     /note="elongator acetyltransferase complex subunit 6"
                     /db_xref="GeneID:54859"
                     /db_xref="HGNC:HGNC:25976"
                     /db_xref="MIM:615020"
     exon            1..176
                     /gene="ELP6"
                     /gene_synonym="C3orf75; TMEM103"
                     /inference="alignment:Splign:2.1.0"
     exon            177..255
                     /gene="ELP6"
                     /gene_synonym="C3orf75; TMEM103"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    184..186
                     /gene="ELP6"
                     /gene_synonym="C3orf75; TMEM103"
                     /note="upstream in-frame stop codon"
     CDS             199..705
                     /gene="ELP6"
                     /gene_synonym="C3orf75; TMEM103"
                     /note="isoform 9 is encoded by transcript variant 20;
                     transmembrane protein 103; angiotonin-transactivated
                     protein 1; UPF0405 protein C3orf75; elongator complex
                     protein 6 homolog"
                     /codon_start=1
                     /product="elongator complex protein 6 isoform 9"
                     /protein_id="NP_001411157.1"
                     /db_xref="GeneID:54859"
                     /db_xref="HGNC:HGNC:25976"
                     /db_xref="MIM:615020"
                     /translation="

MPRQMGVSLYTTFSPSISKGVSLTMARERGQLVFLEGLKSAVDVVFQAQKEPHPLQFLREANAGNLKPLFEFVREALKPVDSGEARWTYPVLLVDDLSVLLSLGMGAVAVLDFIHYCRATVCWELKLRILWRRPSQPAVHRDQSFTYQYKIQDKSVSFFAKGMSPAVL"

     exon            256..374
                     /gene="ELP6"
                     /gene_synonym="C3orf75; TMEM103"
                     /inference="alignment:Splign:2.1.0"
     exon            375..576
                     /gene="ELP6"
                     /gene_synonym="C3orf75; TMEM103"
                     /inference="alignment:Splign:2.1.0"
     exon            577..1134
                     /gene="ELP6"
                     /gene_synonym="C3orf75; TMEM103"
                     /inference="alignment:Splign:2.1.0"
     regulatory      1111..1116
                     /regulatory_class="polyA_signal_sequence"
                     /gene="ELP6"
                     /gene_synonym="C3orf75; TMEM103"
                     /note="hexamer: AATAAA"
     polyA_site      1134
                     /gene="ELP6"
                     /gene_synonym="C3orf75; TMEM103"
                     /note="major polyA site"
ORIGIN      

ggcattgcgcatgcgcgcttccttgcgcgagccgggctgtcgggtgtgttttgctctccagcctccgtcgtctctgcagcactccgggttctcctccagagcgctagtcccaggagctcggaatgttcgtggaacttaataacctgcttaacaccacccccgacagggcggagcaggggaaactgactctactctgtgatgccaagacagatgggagtttccttgtacaccactttctctccttctatctcaaagggtgtcagcctgaccatggcgcgggagcgtgggcagcttgtgttccttgagggactcaagtctgcagtggacgtcgtcttccaggctcaaaaggagccacaccccctgcagtttctcagggaggctaatgctgggaacttgaaaccattgtttgagtttgtacgggaggccctgaagccagtagacagtggagaggctcggtggacgtacccggtgctgttggtggacgacctcagtgtgctcctgagcctgggcatgggggcggtggctgtgctagacttcattcactactgcagagccaccgtgtgctgggaactaaagctgaggatcctgtggaggagaccatcgcagcccgcagtccaccgggatcagagcttcacttaccagtataagatacaggacaaaagcgtgtccttttttgccaaaggaatgtctcctgctgttctgtgacctgatttcggagcagctgaagctacataggactgtttttggacgtggaagatagagcaacatagcaagaatgggtctttctcctctgtagtaatatttcaggctggaccggcgactccactgtgaccagagggttgagtgctgcagtgatggcatgccttggctgccctgggccctgttcagaaaacacaagggaccacaatcctgcctttgctgagagagaggctggatgctagacccaagtgaaaggggtcctttggagcctttgtttaaatatgccttagccccagctgcccatttttggttgacaagcctttcagagccagagtgggtatagatgtgccagccaggagatggcaccggatggcaggtgtgcaaggtgacaactaggataatcatggctggaataaagtaagtttccacactgga

//