GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-03 20:27:32, GGRNA.v2 : RefSeq release 228 (Jan, 2025)

LOCUS       NM_001178224             897 bp    mRNA    linear   PLN 17-DEC-2024
DEFINITION  Saccharomyces cerevisiae S288C pheromone-regulated DUP240 family
            protein PRM9 (PRM9), partial mRNA.
ACCESSION   NM_001178224
VERSION     NM_001178224.1
DBLINK      BioProject: PRJNA128
KEYWORDS    RefSeq.
SOURCE      Saccharomyces cerevisiae S288C
  ORGANISM  Saccharomyces cerevisiae S288C
            Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina;
            Saccharomycetes; Saccharomycetales; Saccharomycetaceae;
            Saccharomyces.
REFERENCE   1  (bases 1 to 897)
  AUTHORS   Engel,S.R., Wong,E.D., Nash,R.S., Aleksander,S., Alexander,M.,
            Douglass,E., Karra,K., Miyasato,S.R., Simison,M., Skrzypek,M.S.,
            Weng,S. and Cherry,J.M.
  TITLE     New data and collaborations at the Saccharomyces Genome Database:
            updated reference genome, alleles, and the Alliance of Genome
            Resources
  JOURNAL   Genetics 220 (4) (2022)
   PUBMED   34897464
REFERENCE   2  (bases 1 to 897)
  AUTHORS   Goffeau,A., Barrell,B.G., Bussey,H., Davis,R.W., Dujon,B.,
            Feldmann,H., Galibert,F., Hoheisel,J.D., Jacq,C., Johnston,M.,
            Louis,E.J., Mewes,H.W., Murakami,Y., Philippsen,P., Tettelin,H. and
            Oliver,S.G.
  TITLE     Life with 6000 genes
  JOURNAL   Science 274 (5287), 546 (1996)
   PUBMED   8849441
REFERENCE   3  (bases 1 to 897)
  AUTHORS   Bussey,H., Kaback,D.B., Zhong,W., Vo,D.T., Clark,M.W., Fortin,N.,
            Hall,J., Ouellette,B.F., Keng,T., Barton,A.B. et al.
  TITLE     The nucleotide sequence of chromosome I from Saccharomyces
            cerevisiae
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 92 (9), 3809-3813 (1995)
   PUBMED   7731988
REFERENCE   4  (bases 1 to 897)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (17-DEC-2024) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   5  (bases 1 to 897)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (31-MAR-2011) Department of Genetics, Stanford
            University, Stanford, CA 94305-5120, USA
  REMARK    Sequence update by submitter
REFERENCE   6  (bases 1 to 897)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (11-DEC-2009) Department of Genetics, Stanford
            University, Stanford, CA 94305-5120, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by SGD. This record
            is derived from an annotated genomic sequence (NC_001133).
            
            ##Genome-Annotation-Data-START##
            Annotation Provider :: SGD
            Annotation Status   :: Full Annotation
            Annotation Version  :: R64-5-1
            URL                 :: http://www.yeastgenome.org/
            ##Genome-Annotation-Data-END##
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..897
                     /organism="Saccharomyces cerevisiae S288C"
                     /mol_type="mRNA"
                     /strain="S288C"
                     /db_xref="taxon:559292"
                     /chromosome="I"
     gene            <1..>897
                     /gene="PRM9"
                     /locus_tag="YAR031W"
                     /db_xref="GeneID:851282"
     CDS             1..897
                     /gene="PRM9"
                     /locus_tag="YAR031W"
                     /experiment="EXISTENCE:direct assay:GO:0005783 endoplasmic
                     reticulum [PMID:26928762]"
                     /experiment="EXISTENCE:direct assay:GO:0005886 plasma
                     membrane [PMID:12101299]"
                     /experiment="EXISTENCE:physical interaction:GO:0005783
                     endoplasmic reticulum [PMID:12925749]"
                     /note="Pheromone-regulated protein; contains 3 predicted
                     transmembrane segments and an FF sequence, a motif
                     involved in COPII binding; member of DUP240 gene family;
                     PRM9 has a paralog, PRM8, that arose from a segmental
                     duplication"
                     /codon_start=1
                     /product="pheromone-regulated DUP240 family protein PRM9"
                     /protein_id="NP_009418.1"
                     /db_xref="GeneID:851282"
                     /db_xref="SGD:S000000078"
                     /translation="
MSPQYHFYFVSFRNLVLNEKCLRSKKQVMKSFNWYKTDRYFDPHNILQHHSRAIEKTRYKLGMQTSSESTDAKSDFLDEPSAYLIEKNVALPKDIFGSYLSYWIYEVTRHKAAVILLVLIVTSILLLVFFYNTEFCVAFEILLFSFCFPGTCMVVIAFSEPIGDREFKVKLLMEIITRKPAVKGKEWRTITYKMNQYLFDHGLWDTPYYFYRDEDCHRYFLSLIKGRTFKKQKESSASNVKDAQSNDETAGTPNEAAESSSFSAGPNFIKLLTKAAEIEQQFQKEYWRQEYPGVDEFF"
     misc_feature    427..696
                     /gene="PRM9"
                     /locus_tag="YAR031W"
                     /note="DUP family; Region: DUP; pfam00674"
                     /db_xref="CDD:395546"
ORIGIN      
atgtcgcctcaataccatttttattttgtatcattccggaacttagtattgaatgaaaaatgcctccgaagtaaaaagcaggtgatgaaaagtttcaattggtataagacagatcgctattttgatccgcataacatccttcaacaccatagcagagctatagagaagacaagatataaactgggcatgcaaacatcttcagaaagtaccgacgccaagtcggattttctcgacgaacccagtgcatatttaattgagaaaaatgtggctcttcccaaggacatattcggttcgtacttaagttattggatatatgaagttactcgtcataaagcggcagtaattttgctcgtacttattgtgacttcaattttattattagtgtttttttataatacggaattttgcgttgcctttgagatactattgttttccttttgctttccaggaacatgcatggttgtaattgcatttagtgaaccgatcggtgatcgggaatttaaagttaagcttctgatggaaattatcacacgtaaaccggcggtaaaggggaaagaatggaggacaattacatacaagatgaaccagtatttatttgatcatgggctatgggatactccctactacttttaccgtgatgaagattgccaccgttattttctaagtcttattaagggaagaactttcaagaagcaaaaggaatcgtcagccagcaatgttaaagacgcacaatcaaatgacgaaaccgctggcacaccaaacgaagccgctgagtcttctagttttagtgccggaccgaactttataaagctcctcaccaaggcagccgaaatcgaacaacaatttcaaaaggaatattggcgacaagagtatcctggtgtcgatgagtttttttag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]