2024-04-24 20:39:08, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001095723 804 bp mRNA linear VRT 17-DEC-2022 DEFINITION Xenopus laevis ladybird homeobox 1 L homeolog (lbx1.L), mRNA. ACCESSION NM_001095723 VERSION NM_001095723.1 KEYWORDS RefSeq. SOURCE Xenopus laevis (African clawed frog) ORGANISM Xenopus laevis Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Amphibia; Batrachia; Anura; Pipoidea; Pipidae; Xenopodinae; Xenopus; Xenopus. REFERENCE 1 (bases 1 to 804) AUTHORS Martin BL and Harland RM. TITLE A novel role for lbx1 in Xenopus hypaxial myogenesis JOURNAL Development 133 (2), 195-208 (2006) PUBMED 16339190 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from DQ294722.1. ##Evidence-Data-START## Transcript exon combination :: DQ294722.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMD00012419, SAMN04111048 [ECO:0000348] ##Evidence-Data-END## FEATURES Location/Qualifiers source 1..804 /organism="Xenopus laevis" /mol_type="mRNA" /db_xref="taxon:8355" /chromosome="7L" /map="7L" gene 1..804 /gene="lbx1.L" /gene_synonym="hpx-6; hpx6; lbx1h" /note="ladybird homeobox 1 L homeolog" /db_xref="GeneID:734237" /db_xref="Xenbase:XB-GENE-6251676" CDS 1..804 /gene="lbx1.L" /gene_synonym="hpx-6; hpx6; lbx1h" /note="ladybird homeobox protein homolog 1; lbx1; ladybird homeobox 1 transcription factor" /codon_start=1 /product="transcription factor LBX1" /protein_id="NP_001089192.1" /db_xref="GeneID:734237" /db_xref="Xenbase:XB-GENE-6251676" /translation="
MTSKDEAKSSASSVEERRRNALDLLPPPANSNKPLTPFSIEDILNKPSVRRSYTICGTAHLLSSADKPPAAGLPLSSRALLSQTSPLCALEELASKTFKGLEVSVLQAAEGRDGMTIFGQRQTPKKRRKSRTAFTNHQIYELEKRFLYQKYLSPADRDQIAQQLGLTNAQVITWFQNRRAKLKRDLEEMKADVESTKKMSPSAVEAVLTISELEESGSERGNSRSRSPQLGLTSNHMPLSPSXPLTDQHASKECSEDEEDVEIDVDD"
misc_feature 1..108 /gene="lbx1.L" /gene_synonym="hpx-6; hpx6; lbx1h" /note="propagated from UniProtKB/Swiss-Prot (Q2PYN8.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature order(382..396,400..402,451..453,469..471,508..510, 514..519,526..531,535..543,547..552) /gene="lbx1.L" /gene_synonym="hpx-6; hpx6; lbx1h" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature 388..549 /gene="lbx1.L" /gene_synonym="hpx-6; hpx6; lbx1h" /note="Homeobox domain; Region: Homeobox; pfam00046" /db_xref="CDD:425441" misc_feature order(388..390,397..399,517..519,526..531,538..540) /gene="lbx1.L" /gene_synonym="hpx-6; hpx6; lbx1h" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" misc_feature 622..801 /gene="lbx1.L" /gene_synonym="hpx-6; hpx6; lbx1h" /note="propagated from UniProtKB/Swiss-Prot (Q2PYN8.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" exon 1..331 /gene="lbx1.L" /gene_synonym="hpx-6; hpx6; lbx1h" /inference="alignment:Splign:2.1.0" exon 332..804 /gene="lbx1.L" /gene_synonym="hpx-6; hpx6; lbx1h" /inference="alignment:Splign:2.1.0" ORIGIN
atgacttccaaagatgaagccaagtcgtccgcgtcctcggtggaggaaagaagaaggaatgccttggaccttttaccacctcctgctaattctaacaagcccctgactcctttcagcattgaggatatcctaaacaagccctcagtccggagaagttacaccatatgtgggacagctcacctactaagcagcgcagataagcctcctgctgcagggctgcccctgtccagcagagcccttctgtcccaaacctcccctctctgtgctctggaagagctggccagcaagacctttaaaggtctggaagtgagtgtcctgcaggcagcagaaggtcgagatgggatgacaatttttggccaaagacagacccctaaaaagaggagaaagtccagaacagcttttacgaaccaccagatttatgagttggagaaacgatttttgtatcagaaatatttatctccggccgaccgtgatcagatcgcccagcagttgggactgaccaatgcccaggtgatcacctggttccagaatcgcagggccaagctgaagagggatctggaggagatgaaggcagatgtggagtcaaccaaaaagatgagcccttcagcagtagaagcagtgctcaccatctctgagttggaagagagcgggtctgagcgaggaaacagtcgcagtaggtcgccccaacttggactaacatcgaaccacatgcccctntccccttcctntccgctcacagaccagcacgcgagcaaggagtgctcggaggatgaggaggatgtggaaattgatgtagacgactga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]