2024-04-25 21:42:32, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001025355 1453 bp mRNA linear VRT 19-SEP-2023 DEFINITION Gallus gallus homeobox B5 (HOXB5), mRNA. ACCESSION NM_001025355 XM_422888 VERSION NM_001025355.1 KEYWORDS RefSeq. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. REFERENCE 1 (bases 1 to 1453) AUTHORS Tang H, Finn RD and Thomas PD. TITLE TreeGrafter: phylogenetic tree-based annotation of proteins with Gene Ontology terms and other annotations JOURNAL Bioinformatics 35 (3), 518-520 (2019) PUBMED 30032202 REFERENCE 2 (bases 1 to 1453) AUTHORS Burge S, Kelly E, Lonsdale D, Mutowo-Muellenet P, McAnulla C, Mitchell A, Sangrador-Vegas A, Yong SY, Mulder N and Hunter S. TITLE Manual GO annotation of predictive protein signatures: the InterPro approach to GO curation JOURNAL Database (Oxford) 2012, bar068 (2012) PUBMED 22301074 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 1453) AUTHORS Wedden SE, Pang K and Eichele G. TITLE Expression pattern of homeobox-containing genes during chick embryogenesis JOURNAL Development 105 (3), 639-650 (1989) PUBMED 2575515 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from AY875647.1. On Jul 14, 2005 this sequence version replaced XM_422888.1. ##Evidence-Data-START## Transcript exon combination :: AY875647.1, AB193110.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA103992290, SAMEA103992323 [ECO:0000348] ##Evidence-Data-END## FEATURES Location/Qualifiers source 1..1453 /organism="Gallus gallus" /mol_type="mRNA" /db_xref="taxon:9031" /chromosome="27" /map="27" gene 1..1453 /gene="HOXB5" /gene_synonym="Ghox-2.1; Hoxb-5" /note="homeobox B5" /db_xref="CGNC:52343" /db_xref="GeneID:425096" exon 1..607 /gene="HOXB5" /gene_synonym="Ghox-2.1; Hoxb-5" /inference="alignment:Splign:2.1.0" CDS 61..855 /gene="HOXB5" /gene_synonym="Ghox-2.1; Hoxb-5" /note="homeo box B5; homeobox protein Hox-2.1" /codon_start=1 /product="homeobox protein Hox-B5" /protein_id="NP_001020526.1" /db_xref="CGNC:52343" /db_xref="GeneID:425096" /translation="
MSSYFVNSFSGRYPNGPDYQLLNYGTSSSMNGSYRDSSTMHSSSYGYNYNGMDLSINRSASSSHFGAVGESSRGFPSPAQESRFRQASSCSLSSPDSLPCSNSESHGGKPAPSPSDQATSASTNTNFTELDETSASSGADEGTPISSSIPRAQAEPIATSTAATEGQAPQIFPWMRKLHISHDMTGPDGKRARTAYTRYQTLELEKEFHFNRYLTRRRRIEIAHALCLSERQIKIWFQNRRMKWKKDNKLKSMSLASAGSAFQP"
misc_feature 625..804 /gene="HOXB5" /gene_synonym="Ghox-2.1; Hoxb-5" /note="Region: homeobox" misc_feature order(628..642,646..648,697..699,715..717,754..756, 760..765,772..777,781..789,793..798) /gene="HOXB5" /gene_synonym="Ghox-2.1; Hoxb-5" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature order(634..636,643..645,763..765,772..777,784..786) /gene="HOXB5" /gene_synonym="Ghox-2.1; Hoxb-5" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" misc_feature 637..795 /gene="HOXB5" /gene_synonym="Ghox-2.1; Hoxb-5" /note="Homeobox domain; Region: Homeobox; pfam00046" /db_xref="CDD:425441" exon 608..1453 /gene="HOXB5" /gene_synonym="Ghox-2.1; Hoxb-5" /inference="alignment:Splign:2.1.0" ORIGIN
cgtcaagcacagggttataacgaccacgagccacaaatcaagccctccaaaataacccaaatgagctcttactttgtaaactcgttctcagggcgctacccaaatggccccgactatcagttactaaattatgggaccagcagttccatgaacggttcttacagagattcaagcaccatgcattccagctcttatggctacaactacaatgggatggaccttagcatcaaccgctcagcctcctctagtcactttggggctgtgggggagagctcccgcggtttcccttctccagctcaggagagcaggtttagacaggcgtctagctgctccttatcttctcccgactcccttccctgctccaacagcgagagccatggaggcaagcccgccccgtccccctccgaccaagctacttctgccagcaccaacacaaatttcacagaactagacgagaccagcgcgtcctcgggagccgacgagggcactccaataagcagcagcatcccccgagcgcaggcagagcccatcgcaacctccacggcagcaacagaagggcaggcacctcagatattcccttggatgaggaaacttcacattagtcatgacatgactggaccagacgggaagagggcgaggacagcgtacactcgctaccagaccctggagttggaaaaggaattccacttcaatagatatctcacccgcaggaggagaatagagatcgctcacgctctgtgcctctccgagaggcagatcaaaatctggttccagaacaggaggatgaaatggaagaaggataataaactgaaaagcatgagcttagcttctgcgggcagcgcctttcagccataaattatagaggaaggaatatcgaggaaagaagaggaaacattaaataaatccgtaaataaataaagcgcagcagatcttagttttggagtactgtacagtgaggcaccttcttttcggcatgttgttgctattcgaaaccgacgcgtatggtacctttatcccaggactgagttcatgtcgtggttttttcttttttgggttgatttattaatttttttcctattatttttttttaattattattaaattttatttccagatgctccccatgctctcgttgtttttataaatgtacgtgtccgtgctatcttgatgctttctggaaagccagcatgttttatgtgagccctataaatgttataacttatttatgagatggtaacagataacgattgtttgtttatttgttgctttttccccttcctgagtttactgctttgggggtgagtttttctctgcctgagctaaaatcgggggttcctgcactacagtcgcagtaaaaaataataataagcaagaaaaaaaaacataaaaaagagggggaaaaaagagaaaaaaaagggggaaaaagattaaaaaaatttaaaaaggggaaaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]