2024-04-24 17:42:01, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001020807 681 bp mRNA linear MAM 19-DEC-2022 DEFINITION Canis lupus familiaris PROP paired-like homeobox 1 (PROP1), mRNA. ACCESSION NM_001020807 VERSION NM_001020807.1 KEYWORDS RefSeq. SOURCE Canis lupus familiaris (dog) ORGANISM Canis lupus familiaris Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Carnivora; Caniformia; Canidae; Canis. REFERENCE 1 (bases 1 to 681) AUTHORS Lantinga-van Leeuwen IS, Kooistra HS, Mol JA, Renier C, Breen M and van Oost BA. TITLE Cloning, characterization, and physical mapping of the canine Prop-1 gene (PROP1): exclusion as a candidate for combined pituitary hormone deficiency in German shepherd dogs JOURNAL Cytogenet Cell Genet 88 (1-2), 140-144 (2000) PUBMED 10773688 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from AF126157.1. ##Evidence-Data-START## RNAseq introns :: single sample supports all introns SAMN11526762 [ECO:0000348] ##Evidence-Data-END## FEATURES Location/Qualifiers source 1..681 /organism="Canis lupus familiaris" /mol_type="mRNA" /sub_species="familiaris" /db_xref="taxon:9615" /chromosome="11" /map="11" gene 1..681 /gene="PROP1" /note="PROP paired-like homeobox 1" /db_xref="GeneID:474647" /db_xref="VGNC:VGNC:45014" CDS 1..681 /gene="PROP1" /note="prophet of Pit1, paired-like homeodomain transcription factor; PROP-1; pituitary-specific homeodomain factor" /codon_start=1 /product="homeobox protein prophet of Pit-1" /protein_id="NP_001018643.1" /db_xref="GeneID:474647" /db_xref="VGNC:VGNC:45014" /translation="
MEAEGRSERGKQKKGRLCGSLWPDSYPAAGTLTSTVDVSPQPSKNLSGVGVRRPRLSPQGGQRGRLHSRRRHRTTFNPGQLEQLETAFGRNQYPDIWAREGLARDTGLSEARIQVWFQNRRAKQRKQERSLLQPLAHLSPATFSGFLPESPACPYSYPTPPPPMTCFPHPYNHALPSQPSTGGSFARPHQSEDWYPTLHPPPTGHLPCPPPPTMLPLSLEPPKSWN"
misc_feature 1..240 /gene="PROP1" /note="propagated from UniProtKB/Swiss-Prot (Q9TTD8.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature order(208..222,226..228,277..279,295..297,334..336, 340..345,352..357,361..369,373..378) /gene="PROP1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature 214..375 /gene="PROP1" /note="Homeobox domain; Region: Homeobox; pfam00046" /db_xref="CDD:425441" misc_feature order(214..216,223..225,343..345,352..357,364..366) /gene="PROP1" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" misc_feature 523..678 /gene="PROP1" /note="propagated from UniProtKB/Swiss-Prot (Q9TTD8.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" exon 1..109 /gene="PROP1" /inference="alignment:Splign:2.1.0" exon 110..342 /gene="PROP1" /inference="alignment:Splign:2.1.0" exon 343..681 /gene="PROP1" /inference="alignment:Splign:2.1.0" ORIGIN
atggaagcggaagggaggagtgagcggggtaagcaaaagaaggggcgactttgcggcagcctctggcctgacagctaccccgctgctgggaccctgacctccacagtagatgtgagccctcagcccagcaagaacctttctggtgtaggcgtgcggagaccaaggctttccccccaaggaggacagaggggtcgcctgcactcccggcgccgccaccgcaccaccttcaacccagggcagttggaacagctggagacagcctttgggaggaatcagtaccccgacatttgggcccgagagggccttgcccgggacacaggcctcagcgaggccagaatccaggtctggttccagaaccgcagagctaagcagaggaagcaagaacggtcgctgctccagccactggcccatctgtctcctgccaccttctctggtttcttgcctgagtcccctgcatgcccctactcctacccaacaccacctccacccatgacctgcttccctcacccctacaaccatgcccttccttctcagccctccaccggtggttcctttgctcgaccccaccagtctgaagactggtaccccaccttgcacccaccccccactggtcatctgccctgtcccccacccccaaccatgcttcccctcagccttgagccaccaaagtcctggaactaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]