GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2024-04-25 17:04:54, GGRNA : RefSeq release 222 (Jan, 2024)



Matches are highlighted with green background. Overlapping matches are dark colored.

PREDICTED: Ostrea edulis uncharacterized LOC125683587 (LOC125683587), ncRNA. (2779 bp)
position 1318 1464 1623 1902 2158 2414
XR_008802991.1 - Ostrea edulis - NCBI
PREDICTED: Saccostrea echinata uncharacterized LOC133200437 (LOC133200437), ncRNA. (353 bp)
experiment="COORDINATES: polyA evidence [ECO:0006239]" /db_xref="GeneID:133200437" ORIGIN // atgattctaagccagaaagtacctaagatacttaaataaagtcataaaatgtcaaaagtaggtcaccgtgacctactttttggtcgacattttccgaaaacccaagatgcatcaactgacaaagtttgacaattctaagccaataagttcctgagatacttaaatatagccataaaatgtcaaaataggtcatggtgacctactttttggttgacattctccgaaaacccaagatgcatcaactgacaaagtttgatgattctaagccaataagtacctaagatacgtaaatatagccataaaatgtcaaaagtaggtcactgtgacctactttttggtcgatgttttccgaa
position 60 187 315
XR_009722940.1 - Saccostrea echinata - NCBI
PREDICTED: Saccostrea echinata uncharacterized LOC133179799 (LOC133179799), ncRNA. (1186 bp)
position 156 392 538
XR_009720176.1 - Saccostrea echinata - NCBI
PREDICTED: Saccostrea echinata uncharacterized LOC133190573 (LOC133190573), mRNA. (3656 bp)
position 1533 1938 2442 2570 2904
XM_061326275.1 - Saccostrea echinata - NCBI
PREDICTED: Saccostrea echinata 3-hydroxybutyryl-CoA dehydrogenase-like (LOC133177755), mRNA. (5390 bp)
position 3829 4121 4267 4393 4648
XM_061312660.1 - Saccostrea echinata - NCBI
PREDICTED: Ostrea edulis uncharacterized LOC125666634 (LOC125666634), mRNA. (4951 bp)
position 1469 1615 1765 1916 2044
XM_048899828.2 - Ostrea edulis - NCBI
PREDICTED: Ruditapes philippinarum uncharacterized LOC132713846 (LOC132713846), ncRNA. (908 bp)
position 255 399
XR_009623496.1 - Ruditapes philippinarum (Manila clam) - NCBI
PREDICTED: Zonotrichia albicollis uncharacterized LOC113460778 (LOC113460778), ncRNA. (617 bp)
position 191 385
XR_003382616.1 - Zonotrichia albicollis (white-throated sparrow) - NCBI
PREDICTED: Ostrea edulis FAD-dependent oxidoreductase domain-containing protein 1-like (LOC125680598), mRNA. (4549 bp)
position 42 189 468 596
XM_048920279.2 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis uncharacterized LOC125651708 (LOC125651708), ncRNA. (5282 bp)
position 1581 1727 1875 2154 2666
XR_008803060.1 - Ostrea edulis - NCBI
PREDICTED: Dreissena polymorpha uncharacterized LOC127879514 (LOC127879514), transcript variant X2, ncRNA. (2109 bp)
position 669 814 959
XR_008049130.1 - Dreissena polymorpha - NCBI
PREDICTED: Ostrea edulis uncharacterized LOC130054058 (LOC130054058), mRNA. (4269 bp)
position 134 428 693 822
XM_056162355.1 - Ostrea edulis - NCBI
PREDICTED: Saccostrea echinata uncharacterized LOC133185684 (LOC133185684), ncRNA. (389 bp)
method: Gnomon." /db_xref="GeneID:133185684" ncRNA 1..389 /ncRNA_class="lncRNA" /gene="LOC133185684" /product="uncharacterized LOC133185684" /db_xref="GeneID:133185684" ORIGIN // aaaaagacagttttttttaaatttcacttaaattaaaggtcacagtgaccttgaaataggttgcgacacaccttctacctaagatgcataaattggccaagtttgatgattctaagtctaatagttttctagttatgagccagacaggatatttccatatttggccataacatcttaattaaaggtcagagtgacctactttaaattgcgacacaccttctacccaagacgtatcagctgacaaagtttgataatcctaggcctaatagtattaaagttatgagccagacacgaaaaagctaacagacggacggaaggacatgaaggctataacataatacgtcctgtcttaagacgggcgtataaaaaatagttttcaaacaataaat
position 37 183
XR_009720934.1 - Saccostrea echinata - NCBI
PREDICTED: Ostrea edulis metallo-beta-lactamase domain-containing protein 1-like (LOC125659624), transcript variant X3, mRNA. (4451 bp)
position 2896 3042 3189 3980
XM_048891361.2 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis metallo-beta-lactamase domain-containing protein 1-like (LOC125659624), transcript variant X2, mRNA. (4476 bp)
position 2921 3067 3214 4005
XM_048891360.2 - Ostrea edulis - NCBI
PREDICTED: Ostrea edulis metallo-beta-lactamase domain-containing protein 1-like (LOC125659624), transcript variant X1, mRNA. (4503 bp)
position 2948 3094 3241 4032
XM_048891359.2 - Ostrea edulis - NCBI
PREDICTED: Haliotis rufescens uncharacterized LOC124143575 (LOC124143575), transcript variant X2, mRNA. (3073 bp)
position 2225 2330
XM_046512601.2 - Haliotis rufescens (red abalone) - NCBI
PREDICTED: Saccostrea echinata ecdysteroid-phosphate phosphatase-like (LOC133172352), mRNA. (7866 bp)
position 5142 5434 5749 6261 6389
XM_061307220.1 - Saccostrea echinata - NCBI
PREDICTED: Haliotis rufescens uncharacterized LOC124143575 (LOC124143575), transcript variant X1, mRNA. (3634 bp)
position 2786 2891
XM_046512600.2 - Haliotis rufescens (red abalone) - NCBI
PREDICTED: Dreissena polymorpha uncharacterized LOC127875043 (LOC127875043), ncRNA. (315 bp)
LOC127875043" /product="uncharacterized LOC127875043" /experiment="COORDINATES: polyA evidence [ECO:0006239]" /db_xref="GeneID:127875043" ORIGIN // ggtcaaggtcactgtgaccttaaatgttaaaatgttaaaattgttataactttggtatgcttggacatagagtcttcaaacttgacatgaaggtttgcaagcacacttagatgaccactggtcatttcaaggtcattcatttgaaggtcgaggtcactgtgaccttggatgtaaatatgttaaagttgttaatactttggtatgcttagacctagagtcttcaaacttgatatgaaggttggccagaactagtagatgaccactggtcattttaaggtcaaggtcaccgtgaccttgaatgtaaaaatgttaaaa
position 6 281
XR_008047228.1 - Dreissena polymorpha - NCBI
PREDICTED: Dreissena polymorpha uncharacterized LOC127859885 (LOC127859885), transcript variant X3, ncRNA. (3726 bp)
position 150 3075 3220
XR_008039512.1 - Dreissena polymorpha - NCBI
PREDICTED: Ostrea edulis carboxypeptidase A4-like (LOC125651525), transcript variant X2, mRNA. (6829 bp)
position 5161 5307 5454 5733 6245
XM_048880160.2 - Ostrea edulis - NCBI
PREDICTED: Dreissena polymorpha uncharacterized LOC127859885 (LOC127859885), transcript variant X2, ncRNA. (3735 bp)
position 150 3084 3229
XR_008039511.1 - Dreissena polymorpha - NCBI
PREDICTED: Dreissena polymorpha uncharacterized LOC127859885 (LOC127859885), transcript variant X1, ncRNA. (3580 bp)
position 150 2929 3074
XR_008039510.1 - Dreissena polymorpha - NCBI
PREDICTED: Ostrea edulis uncharacterized LOC130047798 (LOC130047798), ncRNA. (2314 bp)
position 648 927 1078
XR_008796613.1 - Ostrea edulis - NCBI
PREDICTED: Dreissena polymorpha uncharacterized LOC127874579 (LOC127874579), ncRNA. (956 bp)
position 137 593
XR_008046999.1 - Dreissena polymorpha - NCBI
PREDICTED: Dreissena polymorpha uncharacterized LOC127867709 (LOC127867709), ncRNA. (1081 bp)
position 140 1047
XR_008043623.1 - Dreissena polymorpha - NCBI
PREDICTED: Dreissena polymorpha uncharacterized LOC127847562 (LOC127847562), ncRNA. (441 bp)
ORIGIN // aatgttaaagttcttatttcatggtataactttggtatgcttggacctagagtcttcaaacttgacatgaaggttggccaggattaacagatgaccactggtcatttcaaggtcattcatttgaaggtcaaggtcactgtgaccttcaatataaaaaatgttaaagttgttataactttggtatgcttggacctagagtcttgaaacttgacatgaaggttggccataactagttagtaaccactggtcatttcaaggtcattcatttgaaggtccaggtcactgtgaccttggatgtaaatatgttaaagttgttaatactttggtatgcttagacctagagtcttcaaacttgatatgaaggttggccagaactagtagatgaccactggtcattttaaggtcaaggtcaccgtgaccttgaatgtaaaaatgttaaaa
position 131 407
XR_008034039.1 - Dreissena polymorpha - NCBI
PREDICTED: Dreissena polymorpha uncharacterized LOC127868082 (LOC127868082), ncRNA. (1189 bp)
position 142 1155
XR_008043876.1 - Dreissena polymorpha - NCBI
PREDICTED: Dreissena polymorpha uncharacterized LOC127838520 (LOC127838520), ncRNA. (1112 bp)
position 14 1081
XR_008029839.1 - Dreissena polymorpha - NCBI
PREDICTED: Dreissena polymorpha uncharacterized LOC127864982 (LOC127864982), ncRNA. (1225 bp)
position 138 1191
XR_008042418.1 - Dreissena polymorpha - NCBI
PREDICTED: Sebastes umbrosus FXYD domain containing ion transport regulator 5 (fxyd5), transcript variant X1, mRNA. (1260 bp)
position 802 1063
XM_037785583.1 - Sebastes umbrosus (honeycomb rockfish) - NCBI
PREDICTED: Dreissena polymorpha uncharacterized LOC127842430 (LOC127842430), ncRNA. (1038 bp)
position 128 1004
XR_008031621.1 - Dreissena polymorpha - NCBI
PREDICTED: Ostrea edulis carboxypeptidase A4-like (LOC125651525), transcript variant X1, mRNA. (7310 bp)
position 5642 5788 5935 6214 6726
XM_048880159.2 - Ostrea edulis - NCBI
PREDICTED: Mya arenaria uncharacterized LOC128230181 (LOC128230181), transcript variant X1, mRNA. (2877 bp)
position 1089 1391 1528
XM_052942238.1 - Mya arenaria - NCBI
PREDICTED: Dreissena polymorpha uncharacterized LOC127832704 (LOC127832704), ncRNA. (1232 bp)
position 131 1198
XR_008027069.1 - Dreissena polymorpha - NCBI
PREDICTED: Dreissena polymorpha uncharacterized LOC127848324 (LOC127848324), ncRNA. (1345 bp)
position 132 1311
XR_008034456.1 - Dreissena polymorpha - NCBI
PREDICTED: Dreissena polymorpha uncharacterized LOC127861862 (LOC127861862), ncRNA. (1522 bp)
position 135 1488
XR_008040326.1 - Dreissena polymorpha - NCBI
PREDICTED: Dreissena polymorpha uncharacterized LOC127864259 (LOC127864259), ncRNA. (1368 bp)
position 131 1334
XR_008041653.1 - Dreissena polymorpha - NCBI
PREDICTED: Dreissena polymorpha uncharacterized LOC127861563 (LOC127861563), ncRNA. (1270 bp)
position 135 1014
XR_008040261.1 - Dreissena polymorpha - NCBI
PREDICTED: Dreissena polymorpha uncharacterized LOC127859856 (LOC127859856), ncRNA. (1372 bp)
position 158 1338
XR_008039478.1 - Dreissena polymorpha - NCBI
PREDICTED: Dreissena polymorpha uncharacterized LOC127859887 (LOC127859887), ncRNA. (1377 bp)
position 132 1343
XR_008039513.1 - Dreissena polymorpha - NCBI
PREDICTED: Dreissena polymorpha uncharacterized LOC127840801 (LOC127840801), ncRNA. (1380 bp)
position 135 1346
XR_008030545.1 - Dreissena polymorpha - NCBI
PREDICTED: Dreissena polymorpha uncharacterized LOC127859858 (LOC127859858), ncRNA. (1382 bp)
position 137 1348
XR_008039480.1 - Dreissena polymorpha - NCBI
PREDICTED: Dreissena polymorpha uncharacterized LOC127852913 (LOC127852913), ncRNA. (1515 bp)
position 142 1495
XR_008036353.1 - Dreissena polymorpha - NCBI
PREDICTED: Dreissena polymorpha uncharacterized LOC127860459 (LOC127860459), ncRNA. (1539 bp)
position 148 1505
XR_008039814.1 - Dreissena polymorpha - NCBI
PREDICTED: Mya arenaria endonuclease 8-like 3 (LOC128229319), transcript variant X4, mRNA. (3729 bp)
position 1768 2360 2787
XM_052941176.1 - Mya arenaria - NCBI
PREDICTED: Dreissena polymorpha uncharacterized LOC127867039 (LOC127867039), ncRNA. (1507 bp)
experiment="COORDINATES: polyA evidence [ECO:0006239]" /db_xref="GeneID:127867039" ORIGIN // tgaccttaaaatgaccaattgtcatctactagtgctggccaaccttcatgtccagtttgaagactgtaagtccaagcataagaaagttataccatgaaataagaattttaacatttttacattcaaggtcacggtgaccttgaccttaaaatgaccagtggtcatctactagttctggccaaccttcatatcaagtttgaagactctaggtctaagcataccaaagtattaacaactttaacatatttacatccaaggtcacagtgacctcgaccttcaaatgaatgaccttgaaatgaccagtggtcatctaagtgtgcttgcaaacctttacgtcaagtttgagattctaggtccaagcataccaaagttacaacaatattaacattttaacatttaagttcacagtgaccttgaccttcaaatgaatgacattgaaatgaatgaccttgaaatgaccagtggtcatctaagtgtgcttgcaaacctttacgtcaagtttgagat...
position 126 256
XR_008043236.1 - Dreissena polymorpha - NCBI
PREDICTED: Dreissena polymorpha uncharacterized LOC127856840 (LOC127856840), ncRNA. (1884 bp)
position 150 1850
XR_008038205.1 - Dreissena polymorpha - NCBI
PREDICTED: Dreissena polymorpha uncharacterized LOC127832635 (LOC127832635), ncRNA. (1474 bp)
position 612 757
XR_008027040.1 - Dreissena polymorpha - NCBI

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI :
lang : en | div : | spe : | query_string : iub:aggtcannrtgacct | format : html | download :

0.000 | 0.000 | search_start;
0.102 | 0.102 | count_done;
0.484 | 0.381 | search_done;,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.528 | 0.044 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]