GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-12-06 04:43:38, GGRNA : RefSeq release 208 (Sep, 2021)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

PREDICTED: Asparagus officinalis uncharacterized protein DDB_G0279979-like (LOC109839882), mRNA. (983 bp)
cttcttgatgctacaaagcagaccaagagcaattattgtaaagaattcatgattgagatcaacaggcttaacaggataattgaaaaatgtggaagacatgatgaggttatagacccagtgctgcttaagtcaaatatcaaacagaaaattgcaaatgaaattaggaagaagcgacagggagctcaagaggaacagaagtccaaaacaagcagtgtatataaggaagagcccaccagtcaagaacatgtacataagattgttgaagaggatgtaaagcatcttgctgacgatgaggcaatagaagaggagccagttacttctccaggggagggggtatatagtaaggttgaccagactgtagatactaaggttgatgatagtgtaaataaggaagaggagcatatgcaacatattgtagatatggaagaggagcatatggaacatattgtagatatggaagaggagcatatggtagataaggaagaggagcatatggaagatattgtagataatgaagaggagcgtatggtagataaggaagaggagtatatggtagacaaggaagaggagcatatggaaaatgaaaattttattgtagat...
position 377 410 521 545
XM_020408330.1 - Asparagus officinalis (garden asparagus) - NCBI
PREDICTED: Pecten maximus tripartite motif-containing protein 2-like (LOC117341218), mRNA. (4817 bp)
attgtgagagtatgtaaatattctgtctatagtgtgagagtgtgtacatattctgtctatattgtgagagtatgtacatattctgtctatattgtgagagtatgtacatattctgtctatattgtgagagtatgtacatattctgtctatattgtgagagtatgtacatattctgtctatattgtgagtatgtacatattctgtctatattgtgagagtatgtacatattctgtctatattgtgagagtgtgtacatattctgtctatattgtgagagtatgtacatattctgtctatattgtgagagtatgtacatattctgtccatattgtgagagtatgtatatattctgtctctattgtgagagtatgtacatattctgtccatattgtgagagtatgtacatattctgtctatattgtgagagtatgtacatattctgtctatattgtgatagtatgtacatattctgtctatattgtgagagtatgtacatatactgtccatattgtgagagcatgtatatattctgtctatagtgtgagagtgtgtacatattctgtccatattgtgagagtatgtagatattctgtctatat...
position 2351 2705 3033 3273
XM_033903077.1 - Pecten maximus - NCBI
PREDICTED: Asparagus officinalis Golgi integral membrane protein 4-like (LOC109826477), mRNA. (1068 bp)
cttcttgttgctacaaagcagaccaagagcaaatattgtaaagaattcatgattgagatcaacaggcttaacaggataattgaaaaatgtggaagacatgatgaggttatagacccggtgctgcttaagtcaaatatcaaacagaaaattgcaaatgaaattaggaagaagcgacagggagctcaagaggaacagaagtccaaaacaagcagtgtatataaggaagagcccaccagtcaagaacatgtacataagattgttgaagaggatgtaaagcatcttgctgacgatgaggcaatagaagaggagccagttacttctccaggggagggggtatatagtaaggttgaccagactgtagatactaaggttgatgatagtgtaaataaggaagaggagcatatgcaacatattgtagatatggaagaggagcatatggaacatattgtagatatggaagaggagcatatggtagataaggaagaggagcatatggaagatattgtagataatgaagaggagcgtatggtagataaggaagaggagtatatggtagacaaggaagaggagcatatggaaaatgaaaattttattgtagat...
position 633 666 777 801
XM_020393505.1 - Asparagus officinalis (garden asparagus) - NCBI
PREDICTED: Asparagus officinalis uncharacterized protein PFB0765w-like (LOC109839582), mRNA. (1338 bp)
cttcttgttgctacaaagcagaccaagagcaaatattgtaaagaattcatgattgagatcaacaggcttaacaggataattgaaaaatgtggaagacatgatgaggttatagacccagtgctgcttaagtcaaatatcaaacagaaaattgcaaatgaaattaggaagaagcgacagggagctcaagaggaacagaagtccaaaacaagcagtgtatataaggaagagcccaccagtcaagaacatgtacataagattgttgaagaggatgtaaagcatcttgctgacgatgaggcaatagaagaggagccagttacttctccaggggagggggtatatagtaaggttgaccagactgtagatactaaggttgatgatagtgtaaataaggaagaggagcatatgcaacatattgtagatatggaagaggagcatatggaacatattgtagatatggaagaggagcatatggtagataaggaagaggagcatatggaagatattgtagataatgaagaggagcgtatggtagataaggaagaggagtatatggtagacaaggaagaggagcatatggaaaatgaaaattttattgtagat...
position 735 768 879 903
XM_020408074.1 - Asparagus officinalis (garden asparagus) - NCBI
PREDICTED: Camelus bactrianus uncharacterized LOC105073513 (LOC105073513), ncRNA. (4288 bp)
gaggaaaagaaggttccatgccagactggtcatacttagaagacacttccatatgataaccattgtcttgtgtctgcattttattcctcactactgtatatatagttgacaatgctaagtacttttttgaaatatctagtcttcctagatgttctgaagtgcctgatacatattaaaagtagaggtagtaaaaacattttgtaaatatctttttgttaaaattcatatgaaatattgtttattttgtgggggattggccacaccacctctttgaacagtacacactgcgtttgtgcactg...aaagtatgttaaaagtagaggtagtgaaataacattttgtagatatccttttgttaaaattcatataaaatactgtcttttagaaatggaatgatcaaatgatcacctctctgagcagtacacgttattttatttgtgctggtttgaggaggaagaagtgcaaagggctttataccagtacgtttgtagttaggcaagattaaccattgtcccatacgtacgtctgcattttgttttacttagctgtgtatatagtgtacataaaggacaaacgtcccaacttacatctagtcttcctag...
position 295 400 1573 2325
XR_835704.1 - Camelus bactrianus (Bactrian camel) - NCBI
PREDICTED: Camelus dromedarius uncharacterized LOC105084975 (LOC105084975), ncRNA. (4551 bp)
gaagaaaagaaggttccatgccagactggtcatacttagaagacacttccatatgataaccattgtcttgtgtctgcattttattcctcactactgtatatatagttgacaatgctaagtacttttttgaaatatctagtcttcctagatgttctgaagtgcctgatatatattaaaagtagaggtagtaaaaacattttgtaaatatctttttgttaaaattcatatgaaatattgtttattttgtgggggattggccacaccacctctttgaacagtacacactgcgtttgtgcactg...aaagtatgttaaaagtagaggtagtgaaataacattttgtagatatccttttgttaaaattcatataaaatactgtcttttagaaatggaatgatcaaatgatcacctctctgagcagtacacgttattttatttgtgctggtttgaggaggaagaagtgcaaagggctttataccagtacgtttgtagttaggcaagattaaccattgtcccatacgtacgtctgcattttgttttacttagctgtgtatatagtgtacataaaggacaaacgtcccaacttacatctagtcttcctag...
position 557 662 1837 2589
XR_836755.2 - Camelus dromedarius (Arabian camel) - NCBI
PREDICTED: Asparagus officinalis MATH and LRR domain-containing protein PFE0570w-like (LOC109834872), mRNA. (1320 bp)
Region: DnaJ; cl28246" /db_xref="CDD:333066" ORIGIN // atgattgagatcaacaggcttaacaggataattgaaaaatgtggaagacatgatgaggttatagacccggtgctgcttaagtcaaatatcaaaaagaaaattacaaatgaaattaggaagaagcgacgggaaactcaagaggaacagaagtccaaatcaagcagtgtatataaggaagagcccaccatgcaagaacatgtacataagattgttgaagaggatgtgatgcatcctgctgacgatgaagcaagtaaagaggagcctgttacttctccaggggcgggggtatatagtaaggttgaccagactgtagatactaaggttgaggatagtgtagataaggaagaggagcatatggaagctattgtagatacggaagaggagcatattgtagataaggaagaggagcatatgaaagacattgtagataaggaagaggagcatatggaaaatgaaaattttattgtagataacaaaggttttgatgaggatactgttgatggtgtagataaggaggaagatattgtagataaagagaaggagaa...
position 165 198 309
XM_020402889.1 - Asparagus officinalis (garden asparagus) - NCBI
PREDICTED: Saccoglossus kowalevskii zonadhesin-like (LOC102807195), partial mRNA. (743 bp)
note="ribonuclease E; Reviewed; Region: rne; PRK10811" /db_xref="CDD:236766" ORIGIN // atataccgactgacaccaatgaagtggaaactgaagatgtatgtgctgtagatataccgactgaccccactgaagtagaaactgaaggtgtacgtcctgtggatataccgactgacactactgaagtagaaactgaagatgtacgtcctgtagaaataccaactgatacctctgaagtagaaactgaagatctacgtcctgtatatataccaactgacaccactgaagttgaaactaaagatgtacgtattgtggatataccgactgacactaatgaagtagaaacgaaagatgtacgtattgtggatataccgactgacactaatgaagtagaaactgaagatgtacatataccgactgacaccactgaagttgaaactaaagatgtacgtcctgtggatataccgactgacactaatgaaatagaaactgaagatgtacgtcctgcagatataccgactgacaccactgaagtagaaacagtagaggtacatcctgtagatataccgactg...
position 47 200 344
XM_006820824.1 - Saccoglossus kowalevskii - NCBI
PREDICTED: Limulus polyphemus uncharacterized LOC106476945 (LOC106476945), mRNA. (1182 bp)
ORIGIN // atggtggtagatagagtagaagaacgttatattgtggtagatagagtagaagaacgcactattgtggtagatagagtagaagaacgtagtattgttgtacatagagtagaagaacgtactattgtggtagatagagtagaagaacgtactattgtggtagatagagtagaagaacgtactattctggtagatagagtagaagaacgtactattgtgatagatagagtagaaaaacgtattattgtagtaaagagtgtagaagaacgtactattggtgtagatagagcagaagaacatagagtagaagaacgtagtattctggtagatagagtagaagaacgtactattgtggtagatagagtagaagaacatactattgttgtagatagagtagaagaacgtactattcttgtagatagagtagaagaacgtactattgtggtagatggaatagaagaacgtactattggtgtaaatagagtagaagaacgtactattggtgtaaatagagtagaagaacgtactattgtggtagatagagtagaagaacgtattattgtagtaaagagtgtagaagaacgtactattgg...
position 96 276 471
XM_013937559.1 - Limulus polyphemus (Atlantic horseshoe crab) - NCBI
PREDICTED: Vicugna pacos uncharacterized LOC107033401 (LOC107033401), ncRNA. (4812 bp)
gaagaaaagaaggttctatgccagactggtcatacttagaagacacttccctatgataaccattgtcttgtgtctgcattttattcctcactactgtatatacagttgacaatgctaagtacttttttgaaatatctagtcttcctagatgttctgaagtgcctgatatatattaaaagtagaggtagtaaaagcattttgtaaatatctttttgttaaaattcacatgaaatattgtttattttggggggggattggccacaccacctctttgaacagtacacactgcgtttgtgcact...aaagtatgttaaaagtagaggtagtgaaataacattttgtagatacccttttgttaaaattcatatataatactgtcttttagaaatggaatgatcaaatgatcacctctctgagcagtacacgttattttatttgtgctggtttgaggaggaagaagtgcaaagggctttataccagtacgtttgtagttaggcaagattaaccattgtcccatacgtatgtctgcattttgttttacttagctgtgtatatagtgtacataaaggacaaacgtcccaacttacatctagtcttcctag...
position 823 928 2100 2852
XR_001458870.2 - Vicugna pacos (alpaca) - NCBI
PREDICTED: Bombus impatiens uncharacterized LOC100747124 (LOC100747124), ncRNA. (922 bp)
aaataatgtaaataacttataatacaaatatattatatataattgttacaacagtttaactaattaaaacatcaatgtttcgaaaacaatagtcaattattacagtaattcaaatattcccgcttgcggtatcgatcaagagggaagtacaacatatatatatatatatatatacgtatataaatatgtatatataccgtgcaatgcaacgaaagtgttgcttttgcaatatacattatatttaactacatagatttgaggaatttcagcaaagccatttgatttgaaaaaaacttttaaaaagcttaatataaaaagtgttataagaattaattactagacaagagtataaacttttaactattgtagataacctgtt...gaataaaggaaattacagatgaatataaaaaaaaataattaatgatttatctaataatactattacgtttgtggaataagttttaatccagtttattgtacatatacgtttatatatataaacatgtaacacaatttgatttggtttgattttaataaaacattttatgtaa
position 17 197 375 847
XR_001102096.3 - Bombus impatiens (common eastern bumble bee) - NCBI
PREDICTED: Folsomia candida uncharacterized LOC118439324 (LOC118439324), transcript variant X2, ncRNA. (1929 bp)
ttattataccggtattggcacattcatatgtacatacagaactatactccaataattaattattccagataattcgacaccagttttcttagagtatgggattgtaggtcaagggtttcttatcctccacctgctctatttacggtcattatgtacgtacgtatgtacatatacataaaggaaactttcgttaaatgaggcatccctcccaataaagggaactagtataaactagattccgctaggattttactgattgtatgtatgtatataaatttaggtatgtagttttatgtagtc...tatgtgtatttgcttgcgcatgtaaatataaaaaactgcaatttattcgtggaaatttcttgcatgtctggttcggtttgggtacctgatcctcagcgaaaatacaccatggataaataaatttgcaatataaattcattgtttcctctactactggatgatcagatgtatttaaataattgatatgatatacatatgtagatacgagtatgtaaataaatatatctagtcacgaaatgtatgtattgacaatggacgtacgtaaataaatatgtacatatttgtctcaagaaaaattca...
position 622 859 1443 1619
XR_004837353.1 - Folsomia candida - NCBI
PREDICTED: Asparagus officinalis uncharacterized LOC109838740 (LOC109838740), mRNA. (2435 bp)
cttcttgttgctacaaagcagaccaagagcaaatattgtaaagaattcatgattgagatcaacaggcttaacaggataattgaaaaatgtggaagacatgatgaggttatagacccggtgctgcttaagtcaaatatcaaacagaaaattgcaaatgaaattaggaagaagcgacggggagctcaagaggaacagaagtccaaaacaagcagtgtatataaggaagagcccaccagtcaagaacatgtacataagattgttgaagaggatgtaaagcatcttgctgacgatgaggcaatagaagaggagccagttacttctccaggggagggggtatatagtaaggttgaccagactgtagatactaaggttgaggatagtgtaaataaggaagaggagcatatggaacatattgtagatatggaagaggagcatatggtagataaggaagaggagcatatggaagatattgtagataatgaagaggagcgtatggtagataaggaagaggagcatatggtagataaggaagaggagcatatggaaaatgaaaattttattgtagataacaaaggttttgatgaggatactgttgatggt...
position 811 844 955 979
XM_020407163.1 - Asparagus officinalis (garden asparagus) - NCBI
PREDICTED: Asparagus officinalis uncharacterized LOC109841851 (LOC109841851), mRNA. (1506 bp)
cttcttgatgctacaaagcagaccaagagcaaatattgtaaagaattcatgattgagatcaacaggcttaacaggataattgaaaaatgtggaagacatgatgaggttatagacccagtgctgcttaagtcaaatatcaaacagaaaattgcaaatgaaattaggaagaagcgacagggagctcaagaggaacagaagtccaaaacaagcagtgtatataaggaagagcccaccagtcaagaacatgtacataagattgttgaagaggatgtaaagcatcttgctgacgatgaggcaatagaagaggagccagttacttctccaggggagggggtatatagtaaggttgaccagactgtagatactaaggttgatgatagtgtaaataaggaagaggagcatgttgaggataataaagagaaggagaatgtagataagttggaagtacaggaggaagaggatcttgtgaatattaaacatgatgtggacaaacttgtagatgttctaacgagcaatgtggaagcaaagcgcccaccaaagccaagaagggtaagcaggagatctaaatggaagaggacaccatatactgaaggcaaaaga...
position 609 642 753 777
XM_020410785.1 - Asparagus officinalis (garden asparagus) - NCBI
PREDICTED: Bactrocera tryoni mitochondrial pyruvate carrier 2-like (LOC120777994), transcript variant X2, mRNA. (1828 bp)
ttcttcactatctagcaaacggtgaggaagtcaacaccagtaattgttcaagtaaggtaccttgtataccttgcctttagaataaagttagaaaattgtaaatacgagaaactagtacaaaatatctaatctcaaacgaaacaaaaatctgaaataagtgcttagaaaacaacaataaaatggcttcctcagcacctcca...ctgggccgcgcatacaattaccaaatggaacagaacaaactggctggtgaacaacctgcgaagaagaacgaattgtaaatggctttaatttcgatttgtatataatattcaaatgtttgtatatacacatgtatataatgttaatgagacgcatgctacctacattaattatgcgatcacttttcaatattttctgttct...agcaaaagaaaaaacgaaaaagatacatatgacatttacatactaatatttatgtacatatgtacataagtcgtaagaggctgcacaaattacatagcatagcaaagtacccaattagcatctaacatggaaacagccatatgtagataaatgtgttaattatatgtacatacatatgtattttaggcaatgagaacttt...
position 115 678 1588 1677
XM_040109658.1 - Bactrocera tryoni - NCBI
PREDICTED: Bactrocera tryoni mitochondrial pyruvate carrier 2-like (LOC120777994), transcript variant X1, mRNA. (1828 bp)
ttcttcactatctagcaaacggtgaggaagtcaacaccagtaattgttcaagtaaggtaccttgtataccttgcctttagaataaagttagaaaattgtaaatacgagaaactagtacaaaatatctaatctcaaacgaaacaaaaatctgaaataagtgcttagaaaacaacaataaaatggcttcctcagcacctcca...ctgggccgcgcatacaattaccaaatggaacagaacaaactggctggtgaacaacctgcgaagaagaacgaattgtaaatggctttaatttcgatttgtatataatattcaaatgtttgtatatacacatgtatataatgttaatgagacgcatgctacctacattaattatgcgatcacttttcaatattttctgttct...agcaaaagaaaaaacgaaaaagatacatatgacatttacatactaatatttatgtacatatgtacataagtcgtaagaggctgcacaaattacatagcatagcaaagtacccaattagcatctaacatggaaacagccatatgtagataaatgtgttaattatatgtacatacatatgtattttaggcaatgagaacttt...
position 115 678 1588 1677
XM_040109648.1 - Bactrocera tryoni - NCBI
PREDICTED: Folsomia candida uncharacterized LOC118439324 (LOC118439324), transcript variant X1, ncRNA. (1982 bp)
ttattataccggtattggcacattcatatgtacatacagaactatactccaataattaattattccagataattcgacaccagttttcttagagtatgggattgtaggtcaagggtttcttatcctccacctgctctatttacggtcattatgtacgtacgtatgtacatatacataaaggaaactttcgttaaatgaggcatccctcccaataaagggaactagtataaactagattccgctaggattttactgattgtatgtatgtatataaatttaggtatgtagttttatgtagtc...tatgtgtatttgcttgcgcatgtaaatataaaaaactgcaatttattcgtggaaatttcttgcatgtctggttcggtttgggtacctgatcctcagcgaaaatacaccatggataaataaatttgcaatataaattcattgtttcctctactactggatgatcagatgtatttaaataattgatatgatatacatatgtagatacgagtatgtaaataaatatatctagtcacgaaatgtatgtattgacaatggacgtacgtaaataaatatgtacatatttgtctcaagaaaaattca...
position 622 859 1496 1672
XR_004837352.1 - Folsomia candida - NCBI
PREDICTED: Aethina tumida protein Wnt-1-like (LOC109607506), partial mRNA. (832 bp)
atcacccattagtattttcaaattaattaatcaacatttgaaggtggcgctttcgtcgtcccctcgaagaggcgccactttcaaacagactaatcagtattatagagacgttgtgaaatttatgcaaagactgattttcgattttatcactattatttaattaattcgagtcattgtatatagttatttatgtgtcgatattagttacttaactcatttatttaattaatctaatttattcgctgtacataaaaatcaaacgcaaaaatcagcaggtagtgcatctcaaatcgtgtatatgtacctaatttattattattattattattttcacgttctatttatttgttcattaagttgttgtacatttgacccttctgtaaatattacgccccccttccccccttagttttattacgtgtagataacacacttgtatttcaaacctatttatgattataaacgtacttgtatattatttatattgcgatttattgtaaagttattattaaaaagtcaa
position 487 556 691 732
XM_020023982.1 - Aethina tumida (small hive beetle) - NCBI
PREDICTED: Solanum tuberosum uncharacterized LOC102592064 (LOC102592064), mRNA. (620 bp)
ORIGIN // acctcaattttcaaaattcacaactgtagataaatatcctgtatatattcaatatgaagtttttatcggaattaaggacgtgctatggcggtgcaaccatcaagacggtgatggatgggctaccgccggtggagaaaaaggagtcggagcaagtaaatcgatcggggaataaacgcgtggtttctcggggaaggaaattaaggaaaacggagaattggaaaccggcgctccacgtcatctccgaggacaaagcgatcgccgacgttgatcggtacagttgcgataaaactacggttggaaattccgggaataaaagagcgttaaaagatgacggtagatctggtagagcacggaagaggttcggcgatggttactggaaaatgtcgtacgccgttgcgatgcctgctttctcaggaatgcttttttagtgttgagctgtgtttgtcttgtccttgtaaataattagattttagatttttgttcacctctatggaaatttaacaaaagcaaaaatatatgccttttaatttctttgtatatatattgtaaataaaaaaaatgatgttcaagttaattgatatttggttttg...
position 25 40 454
XM_006360607.2 - Solanum tuberosum (potato) - NCBI
PREDICTED: Salmo trutta homeobox protein SIX3-like (LOC115152829), mRNA. (1966 bp)
ccttttcatctccgttttagtccaagtgatgatgccgctcagtcaagatgcaattctgttttactttatgttcttcagacaatcatttacgttataagcacctttgtactacacttctgtcacttcctgtgtggagtaaatggtgaaatgtggaaccgaatcgttatgactgtatcagatttgtatttttatttcaagattttatattgaattatgtatatgatatctcaaataatgcgctcattctcccggtctgtactatcctatatgtgtagatatgtaaataatgcgatcattctcccggtctgtactatcctatatgtgtacatatgtaaataatgcgatcattctcccggtctgtactatcctatatgtgtacatatgtaaataatgcgatcattctcccggtctgtaatatcctatatgtgtagatatgtaaataatgcgctcgttctcccggtctgtaatatcctatatgtgtagatatgcttgtacataatattgctctcccatctccatcttttctatacttgttcacttttctcgacttggtgttcctacataaaatatttgtcaaaatgtaaaaaa
position 1649 1657 1701
XM_029697683.1 - Salmo trutta (river trout) - NCBI
PREDICTED: Camelus ferus uncharacterized LOC106730107 (LOC106730107), ncRNA. (4818 bp)
gaggaaaagaaggttccatgccagactggtcatacttagaagacacttccatatgataaccattgtcttgtgtctgcattttattcctcactactgtatatatagttgacaatgctaagtacttttttgaaatatctagtcttcctagatgttctgaagtgcctgatacatattaaaagtagaggtagtaaaaacattttgtaaatatctttttgttaaaattcatatgaaatattgtttattttgtgggggattggccacaccacctctttgaacagtacacactgcgtttgtgcactg...aaagtatgttaaaagtagaggtagtgaaataacattttgtagatatccttttgttaaaattcatataaaatactgtcttttagaaatggaatgatcaaatgatcacctctctgagcagtacacgttattttatttgtgctggtttgaggaggaagaagtgcaaagggctttataccagtacgtttgtagttaggcaagattaaccattgtcccatacgtacgtctgcattttgttttacttagctgtgtatatagtgtacataaaggacaaacgtcccaacttacatctagtcttcctag...
position 826 931 2104 2856
XR_001366537.2 - Camelus ferus (Wild Bactrian camel) - NCBI
PREDICTED: Bactrocera latifrons mitochondrial pyruvate carrier 2-like (LOC108968499), transcript variant X1, mRNA. (1893 bp)
ttcttcactatctggcaaacggtgaggaagtcaacaccagtaattgttcaagtaaggtaccttgtataccttgcctttgggattaagttagaaaattgtaaatacgagtaactaatacaaaatatctaatctcaaacgaaagaaaagtctgaaacaagtgcttagataacaacaataaaatggcttcctcagcacctcca...catacaattaccaaatggaacagaacaaactggcaggtgaacaacctgcgaagaagaacgaattgtaaatggctttaatttcgatttgtatataatattcaaatgtttgtacatagacatgtatataatgttaatgagacgcatgcaacctacattaattatcgatcactttgcgatacttgcagtcaatacatactatt...aacgaaaaatatacatacatatgtacatttacatagtaatacagatatttatgtacatacataagtcgtaagaggctgaacaagttacatagcatagcatagcatagtacccaattagcatctaacatggaaacagtcaaatgtagataaatgtgttaattatatgtacatacatgcatatgtattttaggcaatgagaa...
position 162 725 746 1740
XM_018932568.1 - Bactrocera latifrons - NCBI
PREDICTED: Solanum tuberosum putative dual specificity protein phosphatase DSP8 (LOC102603222), mRNA. (1742 bp)
ggtgctgtagttgtgataaccgaaacagatctagatggatataattcaagccttgactctagggtggctggatctgagctttgggcagatttgaatttgatttacagggttcgagttgctggtggggcagccttagcaagactctcctgtatgtggttacgttgccacaccgaccagaagattccgaatcagaaggtgactgcagagagcaagcagctggaaagttttactgtagatatacatgtgttttcttaagttaataagttgtacatatttcttctgtatatataaaatattaagatgctacaagctaaggtgtctactatttcagcttactctaccataaaacctcgacgttctctatgtaaatacgatatacttctcaagttgcaaatgagaagtttgagtatatgtatatatatatagctctttatgcgaaatttcttaacaa
position 476 1522 1557 1655
XM_006359188.2 - Solanum tuberosum (potato) - NCBI
Sphaeroforma arctica JP610 hypothetical protein mRNA. (1407 bp)
cgcccagcacgacgaagagctgttaacgacgtagatgatataaataacttgtaaataattgtatatctaattgtgtatataccccggtgggagtgtcaatgtgacacgacacagcatattcgatactccctgtgttaaacgaaacgactagtatatggtggtgtcaaggcacaacgcgctccacccgtgatacgttcatatacaaggcacatgtattatacttgcgtgcaggtacatgtatgtgagtgtacacgcaagtacatgcatgtgagtgtacgtgccaggcgattcaaagcttgttagaagatgtcgcgaatggaggagggctcgattcccggcggcttgagcgggtatctcggttgagctacccggtaggcttcgtgtacatagagactgcgtgctaagattagttcacaaatttaggcggtaatcatctcgcgagcgtggttacgtgtggggattggtactgcaacaagcatgcacttcatctgtgtatacggacacatacattgcgtgtgtgtgcgtgtgcgtgtgcatatgcacatgtagatatgtatatcggttgtagagcagttgtgcaagtatatctaataaaactga...
position 209 830 854 1325
XM_014297730.1 - Sphaeroforma arctica JP610 - NCBI
PREDICTED: Anoplophora glabripennis coiled-coil domain-containing protein 1-like (LOC108908113), mRNA. (597 bp)
ORIGIN // atgtttcacaaaatcgacccacatttgaatggtgataataatgtagatggtggtgatgtacataatgtaaataatgatgatggtgatgtacatgatggtgatatagatgttgctgtagtagatgatggtaatgtagataatggcgatgtaaatgatggtcaggtagatgacggtgatgtagattatgatgctggcgatgtagatgatggttatgtagaccatggcgatgtagatgtagatgatgtagatgatgttgctgtagatggtggcgatgtagataatggcgatgtagatgatggtgatgtagattatggtgatgtagattatggtggtataaatgatggtggtgtagatgtagatgatgtagatgatagcgatatagatgtagatgagggtcatgtagatgatggcgatgtggatgatagtaatttagatgatggtgatgtagatgatgtgacatgtgatgatggagatgtagatgatagtgatgtagataatagcgatgtagattatggtgatgttgatgatgacgatgtaaatgatggtaatgtaaatgacggtgctgtagaagatgatactgcaattatggt...
position 57 66 132
XM_023454589.1 - Anoplophora glabripennis (Asian longhorned beetle) - NCBI
PREDICTED: Balaenoptera musculus uncharacterized LOC118881207 (LOC118881207), ncRNA. (4418 bp)
tatatgttcaaagtagaggtagtaaaaagacattttgtaaatatctttttgttaaaattcgtatgaaatgttgttttggggggaaggggtggccaaaccacctttttgaacagtacgcagtatgcactgtgtttgtgcactggttcaaggtcggggagaggagaaggaagtgcaaagagctctgtgcagtgtgtttatagtgaggcaagattaaccattgtcttttttatgttcctgcattttgtttcactttgctgtgtatatagtgtatataatggacaaatgagtcctaatttacaa...agtgcacaaagtatgttaaaagtagaggtagtgaagtaacataatttgtagatatatccttttgttaaaatccatatgaaatactgtcttttagaaatggagtgatcaaaatgatcaaaccacctctctgagcagtacacattattttatttgtgctggttcagggagaaagaagaaagtgtaaagggctttataccaagactaaccattgtccggtatgtctctgcgttttgttttacttggctgtgtacatagtgtacataaaggacagaagtccaaatttacaacatctagtcttcc...
position 469 691 1647 2413
XR_005016468.1 - Balaenoptera musculus (Blue whale) - NCBI
PREDICTED: Bombus bifarius uncharacterized LOC117208155 (LOC117208155), ncRNA. (914 bp)
taaataatgtaaataacttataatacaaatatattatatataattgttacaacagtttaactaattaaaacatcaatgtttcgaaaacaatagtcaattattacagtaattcaaatattcccgcttgcggtatcgatcaagagggaagtacaacatatatatatatatatatacgtatataaatatgtatatataccgtgcaatgcaacgaaagtgttgcttttacaatatacattatatttaactacatagatttgaggaatttcagcaaaaaaattttaaaaaagcttaatataaaaagtgttataaaaattaattactagacaagagtataaacttttaactattgtagataacctgttgttactca...taaaggaaattacagatgaatataaaaaaaaataattaataatgatttatctaataatactatgacgtttgtggaatacgttttaatccagtttattgtacatatacgtttatatatataaacatgtaacacaatttgatttggtttgattttaataaaacattttatgtaa
position 14 192 354 839
XR_004487635.1 - Bombus bifarius - NCBI
PREDICTED: Bombus vosnesenskii ras-related protein Rab-21 (LOC117242126), mRNA. (1591 bp)
atcacatcgttatgatcgtcagtcgtcaatatactctataaattgttctatcaacgattattctgcgcaattacgactgtcatattgttttctaagtgtatatattagttatatgcaaattatggccactccaattagtagtactggtaatggttataatttcaaagtcgtgttactcggcgaaggatgtgtcggaaaaa...tggttcttcgcatgcatcttaattccaaatacctgtattgcaattggttctaattttaaacaagtcttatatataaaagtgtgtgtagatatacatgcatgtatgtatatgtacatacacatattgataaaccacatatatatatcacaaaatttttaatattttattttttaagaaacaaaaaataaaatagatataaa...atggattataaacatccacaaatcgatctatagtagcaacataatcgttaattcgttaaattattcatttcttcataacaattttaaataattaagtgtaaatatatagatgtaaatatacgaatggactacttatattcgtagataagaaagaaatttaaaacattagaaa
position 139 894 920 1516
XM_033508548.1 - Bombus vosnesenskii - NCBI
PREDICTED: Bactrocera latifrons mitochondrial pyruvate carrier 2-like (LOC108968499), transcript variant X2, mRNA. (1984 bp)
ttcttcactatctggcaaacggtgaggaagtcaacaccagtaattgttcaagtaaggtaccttgtataccttgcctttgggattaagttagaaaattgtaaatacgagtaactaatacaaaatatctaatctcaaacgaaagaaaagtctgaaacaagtgcttagataacaacaataaaatggcttcctcagcacctcca...catacaattaccaaatggaacagaacaaactggcaggtgaacaacctgcgaagaagaacgaattgtaaatggctttaatttcgatttgtatataatattcaaatgtttgtacatagacatgtatataatgttaatgagacgcatgcaacctacattaattatcgatcactttgcgatacttgcagtcaatacatactatt...aacgaaaaatatacatacatatgtacatttacatagtaatacagatatttatgtacatacataagtcgtaagaggctgaacaagttacatagcatagcatagcatagtacccaattagcatctaacatggaaacagtcaaatgtagataaatgtgttaattatatgtacatacatgcatatgtattttaggcaatgagaa...
position 253 816 837 1831
XM_018932580.1 - Bactrocera latifrons - NCBI
PREDICTED: Bombus vancouverensis nearcticus uncharacterized LOC117153909 (LOC117153909), ncRNA. (930 bp)
taaataatgtaaataacttataatacaaatatattatatataattgttacaacagtttaactaattaaaacatcaatgtttcgaaaacaatagtcaattattacagtaattcaaatattcccgcttgcggtatcgatcaagagggaagtacaacatatatatatatatatatacgtatataaatatgtatatataccgtgcaatgcaacgaaagtgttgcttttacaatatacattatatttaactacatagatttgaggaatttcagcaaagccgtttgatttgaaaaaaattttaaaaaagcttaatataaaaagtgttataaaaattaattactagacaagagtataaacttttaactattgtagataacctgtt...taaaggaaattacagatgaatataaaaaaaaataattaataatgatttatctaataatactatgacgtttgtggaatacgttttaatccagtttattgtacatatacgtttatatatataaacatgtaacacaatttgatttggtttgattttaataaaacattttatgtaa
position 14 192 370 855
XR_004463679.1 - Bombus vancouverensis nearcticus - NCBI
PREDICTED: Belonocnema treatae dehydrodolichyl diphosphate synthase complex subunit DHDDS (LOC117168696), transcript variant X4, mRNA. (1356 bp)
Cis_IPPS; cd00475" /db_xref="CDD:259850" ORIGIN // gtttcaagtcttctgaaaatcctctttgctacaaactcgatgtagatattgattcgaaattatattttcataaaatataatttttatatataaaaagtcaatttccaactttgactcaacgtgaaagaaaaaatgtcttggatacgaga...ggccagaattcactgtatgggacttacttgccgcagttttatattatcaaaggtgtacatatgatttgagattggtagctaagaaggttgaaagcaaacatttaatttgcaacaacagaattacttcctacatttgtaatgtatataaacagagacaaatgttcatagaaaatatatcgcagactgcagttcagtgatta...cattagttttttattttggccacgagtacgagtgtttgagattgaagtagtaaatattaatttctacagtcatgtaaatatgtagaatatttgcatttctacttgcgatttactggaacatgtacatatttttattatattgtattgagcacaatattttcgatgaatttaaataaatttgtttaaatttgaacaac
position 41 880 966 1232
XM_033354381.1 - Belonocnema treatae - NCBI
PREDICTED: Sander lucioperca piggyBac transposable element-derived protein 4-like (LOC116065155), mRNA. (1533 bp)
gggaaagtgccagggaaacagtggtaagggactcagttatgaggcagtgatggagctaattgatgtacagttgctgggcaccggctataaggtctttgtagataatttttatacaagtccaatcctgtttcgtgacctccttctgaagaggatctgggcatgcggaaccatccgcacaaacagaatcggattcccaaggt...gtaattgtaaatactagtacagtgcctgttgaaattgtgcctgcaccacatatcggcgttcatcaaccaccagacccggtgtgtgtagagggagagacggtgttgtctcatgtcatctgatcgttaagaaatttaacacatcagcagaggtgctcattttccatacaggtttatgtttatgggacatatgtatatattta...tctggcatgttgccaataacctgtaaatatatgttgatttagatgtgtaaatagttatatagtaatgcttttttttgcactactttttcaccatagcacttatttgacatctttttacccttttttaccaaagggtccttctttgtgctttgttgcatgtagcacataacctgtacatacataattgtaaatatgtgtat...
position 118 882 1065 1445
XM_031320588.2 - Sander lucioperca (pikeperch) - NCBI
PREDICTED: Teleopsis dalmanni uncharacterized protein slr1851-like (LOC119667189), mRNA. (603 bp)
misc_feature 40..552 /gene="LOC119667189" /note="Uncharacterized protein YjbI, contains pentapeptide repeats [Function unknown]; Region: YjbI; COG1357" /db_xref="CDD:224276" ORIGIN // atgggtaatgtagatatggctaatgtagatatggctaaagtagatattgctaacttcgatatggctagtgtaggtatgactagtgtagatataactgatgcatatatcactaatgtatatatggctaatgtatataatgctaatgtagatataactgatgcatatatcactaatgtatatatggctaatgtatataatgctaatgtagatataactgatgcatatatcactaatgtatatatggctaatgtatataatgctaatgtagatatggctaatgtagatatggctaatgtagatatggttaatgtagatatgggtgatataaatatggctagtgtagatatggctaatgtagatatggctaatgtagatatggctaatgtagatatggctaatgtagatattgctaactt...
position 9 114
XM_038076478.1 - Teleopsis dalmanni (Cyrtodiopsis dalmanii) - NCBI
PREDICTED: Saccoglossus kowalevskii uncharacterized LOC102802270 (LOC102802270), ncRNA. (1124 bp)
gene="LOC102802270" /product="uncharacterized LOC102802270" /db_xref="GeneID:102802270" ORIGIN // caactaacataatcattgtcctgaatactacaaatgctatgtacatattgtttgtagaccatctcgtggccgggcaggaccaagatcagcttggggaggtcaaataggaggtactggtgttaatcacaaggctggtagtggactaccgagggcagtgttatctaggactccatctagttctactttggattcaaaagaagaa...tagattgtctatggttttctactcatgtagataaactcattgaaaatgtatgaagagtaaattggcccacacattgattgttagtttttttcattgtcatttacaatattgtacacaccatgtagatttccatgcagtcttccaatttcatagtattaatgaaaagatcaaatatatatttttcagattgctgatcatagattgagccaacttcaaaacacaaaaccttggtttcatgtatgtgtatatattcaaagttgtgtacatttgtaaataataataaataaaattgtgatacca...
position 40 840 1057 1083
XR_438312.1 - Saccoglossus kowalevskii - NCBI
PREDICTED: Bactrocera dorsalis mitochondrial pyruvate carrier 2 (LOC105228525), mRNA. (1921 bp)
ttcttcactatctagcaaacggtgaggaagtcaacaccagtaattgttcaagtaaggtaccttgtataccttgcctttaggataaagttagaaaattgtaaatacgagtaactagtacaaaatatctaatctcaaacgaaacaaaagtctgaaacaagtgcttagacaacaacaataaaatggcttcctcagcacctcca...catacaattaccaaatggaacagaacaaactggcaggtgaacaacctgcgaagaagagtgaattgtaaatggctttaatttcgatttgtatataatattcaaatgtttgtacatacatatgtatataatgttaatgagacgcatgctacctacattaattatgcgatcacttttcgatattttctgtcactttacatgtg...aacaggtttgagccaaagaaaaaacgaaaaagatatgtacatatgtacatttacatactaatacagatatttatgtacatacataagtcgtaagaggctgcataagttacatagcatagcatagtacccaattagcatctaacatggaaacagccatatgtagataaatgtgttaattatatgtacatgcatacatacat...
position 235 798 819 1765
XM_011208391.3 - Bactrocera dorsalis (oriental fruit fly) - NCBI
PREDICTED: Rhagoletis zephyria uncharacterized LOC108375064 (LOC108375064), mRNA. (1733 bp)
agatttctgactatgttgctagctgggtatgtttgtttgtgtattgcttaccttttgtatttgtttgttgacaggtatttgtttatttacacagtttaaaatgtgtgtacatatgttcctaaaatacttggggcctgcggcacattatacatacgaatataatacgtatgtatgtacatatgtatgtatgtatataatgtgtataatttttattttatctaaaaaaaagtaattgataagcgcctgaccactaacaacgcatggcaacaaatatattaaatataaacatatctaaatgcc...ttttgattgaattagacgttatctagtttagaagccaggtatcaatgtaagtgatcaaagtagttgtgaagtattttagttgtaatttttttttttgtaaatacgagtacattatcaagttcaagtatatgtatatatatatctatctatgaatgcatgtatttgtactatacatcattcattttattcataagatttgtagataagtgaatattttatagttaaaaagtagttttgtaatgtcgtaataaaagggaattttaatttactaatacaccttatgttttgcacattaggatg...
position 130 213 1408 1510
XM_017631144.1 - Rhagoletis zephyria (snowberry fruit fly) - NCBI
PREDICTED: Nasonia vitripennis uroporphyrinogen-III synthase (LOC100114801), mRNA. (1309 bp)
aagccactactacttccatgcagtgatattgcaagagatacaataccacaaattttattaaacaataaaatagaagtaaaaaaaattgttgtatataaaacaaaagctcatcattttttagcagaagcattaaatgaagctttaaaccaatcaccacatgttttagtattctatagtccatcaattgtagataatatgttgaatgccttatctaataataagactatatttgaaaatttcaaaattattgcaattggtcctgttactgaagaagctttagaaaatgcaggaatcaaagttgatggagtagctgaaaaaccagaacctacatccttgactgaagtcatacagaaaatcatttaattgcgaagttaggttttgttcataatgaagacaaattatgaagcactgattacatattaatttttgtttatttatgtaaatattttatacatatcgtaatttttataactttaatgaattttaaaattctctatggtaaattgtacatatttttaagaattatacatgccacataaatcttataaattaaaatgtgtattttattttttgataaaagcatcaattctgaaaata
position 210 802 898 1150
XM_001599656.6 - Nasonia vitripennis (jewel wasp) - NCBI
PREDICTED: Phascolarctos cinereus yippee like 3 (YPEL3), mRNA. (1020 bp)
cccaatattctccttgataagatgattctgctgcccccaccccagccaggctgctggaggaggggcactggtgggagaaacaactacttgcttcctctccagggaccctggggaactgcaaattctccctcctcagggctttgttgggagatggccccaagcccttgtatatacattttattattttattgcatgcactgtgactttttttggggggggtaggggaagaaatgtccctgttctgcagccccccatgatctggctggtttggatctaatttttaaccctctcccttaccccagattcacctgtagatacgccctttgttgtacataactccccggcttccttgtcctcctgcctatatacctcaagcctgtgccactctttccctatgatttccttgtcccttcatggtctgtagcatctgtaaataaaactcccggagataccactca
position 728 872 890 991
XM_021006645.1 - Phascolarctos cinereus (koala) - NCBI
PREDICTED: Folsomia candida uncharacterized LOC118438050 (LOC118438050), mRNA. (1355 bp)
taaaaagtgaagaagaggagaattctgtttgagacgatttaaatattatttgatttagcacatgcaatatgtttgtttataattatcgaaaactgttaactgtagaaagtatatgcaggcggtattatgcataataatatattcttaatatgtatatgtatatacatagttactgatatgtattatgcatatgtatttctcaaaactgcataagatgtattcaattttttggaccacatgagctaaaaccgtacgtttacaggaaatgataaaagatggaaaaggaaatcactcgtgacaagtatcatacgtaaagcgactccattcttgtcataaacaaactcatgcaaataatcgtaaaattgtaacctctcagtggatagtgtacaaacagcgtatagccaatatttacatgtacatacatacatatgtagatatgtaaatacaattacctatacatgttttacacaaataaaattggaatcaaatcacaaaaataaaattaatcgctgtgtctccttctatccaa
position 306 983 1240 1264
XM_035857743.1 - Folsomia candida - NCBI
PREDICTED: Bactrocera latifrons alcohol dehydrogenase (LOC108966662), mRNA. (1026 bp)
tcactttctgtcccggtttgactgatacgcccttgaagaacaacattgccaccaaatatacttttgagtactccaaggtgattggtgagaagctgaacaacaccaagacacagaaacccgaagcttgtggcgctcatttggctgaggtggtcgagtcagccgagaatggtggcatctatatmagcaaccaaggtactttgtccaaggtcacaccgaccgtctactggcaacccacattcaactaggctttccagcgcacatctgagatattttgaaatattgtatatacatgtaaatatgtacatacgtatgtgtagatatatatatatatatatatatatgtatgttatttagtttataagttaaaagtctgaattgaataaatcttcattagttttacattaaaa
position 900 910 918 932
XM_018929682.1 - Bactrocera latifrons - NCBI
PREDICTED: Belonocnema treatae dehydrodolichyl diphosphate synthase complex subunit DHDDS (LOC117168696), transcript variant X3, mRNA. (1406 bp)
tgtcttaacgcgttatattctcctttatttaatgtttaatagttgtttcaagtcttctgaaaatgtgacacctctttgctacaaactcgatgtagatattgattcgaaattatattttcataaaatataatttttatatataaaaagtcaatttccaactttgactcaacgtgaaagaaaaaatgtcttggatacgagat...ggccagaattcactgtatgggacttacttgccgcagttttatattatcaaaggtgtacatatgatttgagattggtagctaagaaggttgaaagcaaacatttaatttgcaacaacagaattacttcctacatttgtaatgtatataaacagagacaaatgttcatagaaaatatatcgcagactgcagttcagtgatta...cattagttttttattttggccacgagtacgagtgtttgagattgaagtagtaaatattaatttctacagtcatgtaaatatgtagaatatttgcatttctacttgcgatttactggaacatgtacatatttttattatattgtattgagcacaatattttcgatgaatttaaataaatttgtttaaatttgaacaac
position 91 930 1016 1282
XM_033354380.1 - Belonocnema treatae - NCBI
PREDICTED: Lingula anatina serine/threonine-protein kinase mos (LOC106172125), mRNA. (2406 bp)
tatatgtatttatttgtaaattttcataatttgtatagatttaatttgaactgtatatgtgttaatattctcttgtaaatatgtatacacgattttgtaaaagtggcaaatatctagcatgcagacttcaatgagtttgaagtacctgtacatatgttgatatattttctaagttcattgggtttcatttgtttcaaatgtatagtgtaagtaagtcctatggagcgctgtaatataaacatttcaatggaatcagattcgtcaccatcaaggaaaatagtcattgacgatttgataccttcggcaagactgcttaacttcttgcggtgtctgcatagcatttagactttctaatatgtatatagttcatttcgtggaagtataggaatgttttcatcaacatgtaggacctatcatatttggtgtttatatctgtatataaaaaattactgtacattcaaagacaaattgtacattatattgttttgcacggacagtttcaatatgtacataagggcattgtagatagatatttattgtttgtagatagtatgtataaaagagttaagccctcacagaaaaaaaattaaatgatatata...
position 1613 1686 1896 2060
XM_013552724.2 - Lingula anatina - NCBI
PREDICTED: Medicago truncatula uncharacterized LOC11442322 (LOC11442322), transcript variant X3, mRNA. (1299 bp)
ORIGIN // ttttccttaattatgtttttgtattgatcatgtgtcaaattgggtttttagttctctgaattgtggttgtgttgaaaatgagtgtctatgttcaatgtacttagaactaatgttttgggtttggttttgggtgtatatacattcaatgtatattgcacaattttcaggacatgtgtgtttgataagattttgttttggtctcttttttatgaaaagctataaaactcatttctactacctttttgtgctctagttcaagtttatcaccaaacttttctgattttaatctt...tgtgtagcttctgttcttttcttgctttgagtgagaatcacaacaatgtggtgaaattgggagcaagagaaacatgtttgaagtgtggtggtgactttgtagtttgaaatttgttgatgtaaatatcaatgtagatatgagaattgattgaatgctcaatcagtgttctcgaatttgtacataaattttgtataataatataagtttattttgtata
position 132 933 1212 1258
XM_024785081.2 - Medicago truncatula (barrel medic) - NCBI
PREDICTED: Vombatus ursinus yippee like 3 (YPEL3), mRNA. (983 bp)
ccccatgattctccctgataagatgattctgctgcccctaccccagccaggctgctggaggaggggcactggtgggagaaacaactacttgcttcctctccagggaccctggggaactgcaagttctccctcctcagggctttgttgggtgatggccccaagcccatgtatatacattttattattttattgcatgcactgtgacttttttgggggggcaggggaagaaatgtccctgttctgctgccccccatgatctggctggtttggatctcatttttaaccctctcccttaccccagattcacctgtagatatgccctttgttgtacataactcctcagcttccttgtcctcctgcctatatacctcaagcctgtgccactctttccccatgatttccttgccccttcgtggtctgtagcatctgtaaataaaactcccggagatacca
position 697 839 857 958
XM_027862744.1 - Vombatus ursinus (common wombat) - NCBI
PREDICTED: Pseudomyrmex gracilis bone morphogenetic protein receptor type-1B (LOC109853566), transcript variant X2, mRNA. (2182 bp)
acaagatgggataacgattcgattctgtacgcgttaagcaaaatcatgtcggaatgttggcacgtgaatccgctagttcgcttaactgctcttcgcgttaaaaagacactgtcaaaactgcatgtcaataacagcatcggcgtcaagatcgtgtagggtcgcttgatacaatgaaaaacagaacggactcttttaaaattatacaaataacttccttgtaaatacatcctcattgtacatagaactgttgacagactgcaacttgtgaagactgatgattaagattttgtagataaataagagcgaatgagaacgtacgaatgacgaggtatgcatcaaggcgtgaatgactaatcgtaagagatgcgaatctgttgtgtatatacatatttgaattgtgtacacagaaatatttttatatatatagcgtctcctcgattttgcgcattgtcttttcatgagaacgaaatgtcttcttatcgaagaattttttttccaagaaaggcgcaagcgtgagaaatttggaggttctatatatacaattttttatatttatataaaatgtgtcgcgcgcgcgttgaagccttaatttcgatacgt...
position 105 1697 1751 1841
XM_020425799.1 - Pseudomyrmex gracilis - NCBI
PREDICTED: Sarcophilus harrisii fibroblast growth factor binding protein 1 (FGFBP1), mRNA. (2058 bp)
catggtttgtatagatgcataccaggttgttgtgtacatgtaaatatacacatataaatgtagatgtgtatatatacatatatatgcaaattgcaaagcacatggtctgtatagatacatacaaggtgtgtgtgtacatgtaaatatacatgaaggtagatctaggtctatatacacatgtgtatgtacatgcaaatgtgcacaggtacatgatctgtgtaaatacataaactgtgtgtcttatgtacacataaatatacatgtgggtaaatgtagggacataaacgtgtatatacatgcaaatgtgcacaggtgcaaggtctgtctagatacaaggtggttgtatgtgtgtacacataaatatacatgcaggtagatgtaggtgtatatatacatatgtgtgtacatgcaaatgtgcacaggtacatggtcggtatagatacatacaaggttgtttttgtggatttgtggattcataaatatacatacaggtagttgtaggtacatatacacatgtgtatatacatgcaaaatgcatataggtccatggtctgtgtagataaacacaaggtggttgtatgtgtgtgcacataaacatac...
position 1060 1272 1788
XM_012552314.2 - Sarcophilus harrisii (Tasmanian devil) - NCBI
PREDICTED: Cicer arietinum protein NBR1 homolog (LOC101498514), transcript variant X1, mRNA. (990 bp)
atttctaacaaatatttgattaaagaacttttgtaaatacaatttcagtaagggatgtatttatcttctgtatatacaattggttgtaacttcttcatcgctttcgttctcatagctatggactctgctatggtgatcaaggtgaaatatgaagatactctcaggcgcttcagtgctagtgtggaagagaacagtcgcctggatcttaatatggttgggttgagagctaagataagttctattttcaacttcaccgcctatgcaaattttattctgaggtatgttgatgaagatggagacttggtgaatcttgtggatgatgatgatttgcgtgatgtgatgagacaacaattaaaattcttgagaattgatgtacatatgatcaataattctggtggtaaatcagatgctgatggttctagtggaagtgccacccctttaaacatgatttgaggcttgtactagcagcctccagtgtcggtcgacaggtggaggctggaaatgtgggagtcgccccagttgatctcaatactctccatgtgatccatattcacacattaatgtagatagtgcaccactttcatcagcagttcatgtaag...
position 221 258 561 751
XM_004503142.3 - Cicer arietinum (chickpea) - NCBI
PREDICTED: Sus scrofa uncharacterized LOC110257452 (LOC110257452), ncRNA. (4795 bp)
aagagaaggggggtggtcttatgctagaatgctcacatttggaagacactttcagattataactgttacatgtcgcagtttattgagactgctctgtatatagtggacaaattaagtccttatttgaaacatctagtccacctagatgtttagaagtgcccgacgtatgttaaatgtagaggtagtaaaatatcactttgtaaatagcttttagctaaaattcataggaaatattgtcttttgaaaatggaattgttaaaccacctctgtgaccagtagtttggagtaggtgagaaggaa...acaaagtatgttaaaagtagaggtagtgaaataacattttgtagatatctttttgttaaaattcatatgaaatattgccttttagaaatggaataatcaaaccacctctttgagcagtgcacattattttatttgtgctggttcaaggaggaagaaaaaagtacaaagggctttataccaatatgtttatagttaggagagattaaccatcgtcctgtatgtctgtgttttgctttacttagttgtgtatatagtgtacataaaggacagatgtccaaatttacatctagtcttcctaga...
position 1155 1164 1532 2823
XR_002340060.1 - Sus scrofa (pig) - NCBI
PREDICTED: Papaver somniferum E3 ubiquitin-protein ligase AIRP2-like (LOC113309183), transcript variant X3, mRNA. (994 bp)
tgtcttacccaattgcaaccactcgttgtgtatgaactgctatcgtgattggcatgcacggtctaaatcgtgcccattctgtcgtgacagtcttaaaagagtaggctcagcagacctttggatattcacggacagccgtgaaattatagacacatcttcaatgtgcaaagaaaatttaaagaggctattcatgtatgtagataagttacctgctgctcttccgaatcctcatgtatgtatttccgcttatgattcttctcgtcaactcaagtgagaaatggttgttttcaagtaattgcaagcaacaagttgtaaatagaaaatctttctgtacatagaaatgaaaattacgatgatttattgatttgctttggtactgatttatggaacaaacatttgtatatacaaattgtaacatctatattgatttgcttctctactctata
position 744 859 878 946
XM_026557594.1 - Papaver somniferum (opium poppy) - NCBI
PREDICTED: Drosophila miranda uncharacterized LOC117189170 (LOC117189170), ncRNA. (784 bp)
tacacccatacatacaaatacatatatgtatgtacatatgtatataaaagcgaacccgaagcaaaggcacaaagcaaaatcgccaaaagcgaacatatgtatgtgcacacttatgaaaacccaattttctttttacgcttcgatttctgtatacgaatcgatgatacccaaaaacgaagggccaaaacgagacgcaatgacaaatggttggtggataagcgatggcggaattagcggtgtgtgaaaagggagaggagagccgggtacaaaggaagtatagaaagcgaaaaatacgatatatattacgttagagatgaccaggatcccaggaggcttaatttttcgaaaaagaatttccgagttcacgcccaactctgattgcccgctcaattaaagagcggaatgaacgagagccctgttaaaaatatgtttgattcgattgtctctgactggcaaacttcaattgttctagtatactcgtacactgctcttggtcacttgaatatatgcacttaaactaattatttttttgaagaaaaagtaacttatattaaaatttaatttgtagatattgtaaatcttagatttattagaaaaaga...
position 3 101 738
XR_004473226.1 - Drosophila miranda - NCBI

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/iub%3aUGUANAUA
lang : en | div : | spe : | query_string : iub:UGUANAUA | format : html | download :

0.000 | 0.000 | search_start;
5.786 | 5.786 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=((nt:TGTAAATA)%7C(nt:TGTATATA)%7C(nt:TGTAGATA)%7C(nt:TGTACATA))?to=0&format=json
8.031 | 2.245 | search_done; http://172.18.8.71:7700/v1/refsub/query?q=((nt:TGTAAATA)%7C(nt:TGTATATA)%7C(nt:TGTAGATA)%7C(nt:TGTACATA))?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
8.043 | 0.012 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]