# [ GGRNA.v2 | 2024-04-29 02:27:34 ]
#
# seq:GAACACTTCAAACATCGCTAAGCAT	8
# [INTERSECTION]	8
#
# accession	version	gi	length	symbol	synonym	geneid	division	source	definition	nt_position	aa_position
NM_001159597	NM_001159597.3		1687	SH3YL1	RAY	26751	RefSeq	Homo sapiens (human)	Homo sapiens SH3 and SYLF domain containing 1 (SH3YL1), transcript variant 2, mRNA.	1274	
NM_015677	NM_015677.4		1744	SH3YL1	RAY	26751	RefSeq	Homo sapiens (human)	Homo sapiens SH3 and SYLF domain containing 1 (SH3YL1), transcript variant 1, mRNA.	1331	
NM_001282682	NM_001282682.2		1815	SH3YL1	RAY	26751	RefSeq	Homo sapiens (human)	Homo sapiens SH3 and SYLF domain containing 1 (SH3YL1), transcript variant 3, mRNA.	1402	
NM_001282687	NM_001282687.2		1963	SH3YL1	RAY	26751	RefSeq	Homo sapiens (human)	Homo sapiens SH3 and SYLF domain containing 1 (SH3YL1), transcript variant 4, mRNA.	1550	
NR_104225	NR_104225.1		2025	SH3YL1	RAY	26751	RefSeq	Homo sapiens (human)	Homo sapiens SH3 and SYLF domain containing 1 (SH3YL1), transcript variant 7, non-coding RNA.	1587	
NR_104226	NR_104226.1		2497	SH3YL1	RAY	26751	RefSeq	Homo sapiens (human)	Homo sapiens SH3 and SYLF domain containing 1 (SH3YL1), transcript variant 8, non-coding RNA.	2059	
NR_104227	NR_104227.1		3319	SH3YL1	RAY	26751	RefSeq	Homo sapiens (human)	Homo sapiens SH3 and SYLF domain containing 1 (SH3YL1), transcript variant 9, non-coding RNA.	2881	
NR_104223	NR_104223.2		3368	SH3YL1	RAY	26751	RefSeq	Homo sapiens (human)	Homo sapiens SH3 and SYLF domain containing 1 (SH3YL1), transcript variant 5, non-coding RNA.	2955