# [ GGRNA.v2 | 2024-05-05 13:48:18 ] # # seq:CAGGGCTGTCATCAACATGGATATG 28 # [INTERSECTION] 28 # # accession version gi length symbol synonym geneid division source definition nt_position aa_position XM_054326702 XM_054326702.1 2341 FHL1 FCMSU; FHL-1; FHL1A; FHL1B; FLH1A; KYOT; RBMX1A; RBMX1B; SLIM; SLIM-1; SLIM1; SLIMMER; XMPMA 2273 RefSeq Homo sapiens (human) PREDICTED: Homo sapiens four and a half LIM domains 1 (FHL1), transcript variant X6, mRNA. 1947 XM_047441927 XM_047441927.1 2341 FHL1 FCMSU; FHL-1; FHL1A; FHL1B; FLH1A; KYOT; RBMX1A; RBMX1B; SLIM; SLIM-1; SLIM1; SLIMMER; XMPMA 2273 RefSeq Homo sapiens (human) PREDICTED: Homo sapiens four and a half LIM domains 1 (FHL1), transcript variant X6, mRNA. 1947 XM_054326698 XM_054326698.1 2441 FHL1 FCMSU; FHL-1; FHL1A; FHL1B; FLH1A; KYOT; RBMX1A; RBMX1B; SLIM; SLIM-1; SLIM1; SLIMMER; XMPMA 2273 RefSeq Homo sapiens (human) PREDICTED: Homo sapiens four and a half LIM domains 1 (FHL1), transcript variant X2, mRNA. 2047 XM_006724746 XM_006724746.4 2441 FHL1 FCMSU; FHL-1; FHL1A; FHL1B; FLH1A; KYOT; RBMX1A; RBMX1B; SLIM; SLIM-1; SLIM1; SLIMMER; XMPMA 2273 RefSeq Homo sapiens (human) PREDICTED: Homo sapiens four and a half LIM domains 1 (FHL1), transcript variant X2, mRNA. 2047 XM_054326697 XM_054326697.1 2491 FHL1 FCMSU; FHL-1; FHL1A; FHL1B; FLH1A; KYOT; RBMX1A; RBMX1B; SLIM; SLIM-1; SLIM1; SLIMMER; XMPMA 2273 RefSeq Homo sapiens (human) PREDICTED: Homo sapiens four and a half LIM domains 1 (FHL1), transcript variant X1, mRNA. 2097 XM_006724743 XM_006724743.3 2491 FHL1 FCMSU; FHL-1; FHL1A; FHL1B; FLH1A; KYOT; RBMX1A; RBMX1B; SLIM; SLIM-1; SLIM1; SLIMMER; XMPMA 2273 RefSeq Homo sapiens (human) PREDICTED: Homo sapiens four and a half LIM domains 1 (FHL1), transcript variant X1, mRNA. 2097 XM_054326700 XM_054326700.1 2503 FHL1 FCMSU; FHL-1; FHL1A; FHL1B; FLH1A; KYOT; RBMX1A; RBMX1B; SLIM; SLIM-1; SLIM1; SLIMMER; XMPMA 2273 RefSeq Homo sapiens (human) PREDICTED: Homo sapiens four and a half LIM domains 1 (FHL1), transcript variant X4, mRNA. 2109 XM_024452354 XM_024452354.2 2503 FHL1 FCMSU; FHL-1; FHL1A; FHL1B; FLH1A; KYOT; RBMX1A; RBMX1B; SLIM; SLIM-1; SLIM1; SLIMMER; XMPMA 2273 RefSeq Homo sapiens (human) PREDICTED: Homo sapiens four and a half LIM domains 1 (FHL1), transcript variant X4, mRNA. 2109 NM_001330659 NM_001330659.2 2099 FHL1 FCMSU; FHL-1; FHL1A; FHL1B; FLH1A; KYOT; RBMX1A; RBMX1B; SLIM; SLIM-1; SLIM1; SLIMMER; XMPMA 2273 RefSeq Homo sapiens (human) Homo sapiens four and a half LIM domains 1 (FHL1), transcript variant 10, mRNA. 1710 NR_027621 NR_027621.2 2583 FHL1 FCMSU; FHL-1; FHL1A; FHL1B; FLH1A; KYOT; RBMX1A; RBMX1B; SLIM; SLIM-1; SLIM1; SLIMMER; XMPMA 2273 RefSeq Homo sapiens (human) Homo sapiens four and a half LIM domains 1 (FHL1), transcript variant 8, non-coding RNA. 2194 NM_001159703 NM_001159703.2 2181 FHL1 FCMSU; FHL-1; FHL1A; FHL1B; FLH1A; KYOT; RBMX1A; RBMX1B; SLIM; SLIM-1; SLIM1; SLIMMER; XMPMA 2273 RefSeq Homo sapiens (human) Homo sapiens four and a half LIM domains 1 (FHL1), transcript variant 6, mRNA. 1792 XM_054326699 XM_054326699.1 2656 FHL1 FCMSU; FHL-1; FHL1A; FHL1B; FLH1A; KYOT; RBMX1A; RBMX1B; SLIM; SLIM-1; SLIM1; SLIMMER; XMPMA 2273 RefSeq Homo sapiens (human) PREDICTED: Homo sapiens four and a half LIM domains 1 (FHL1), transcript variant X3, mRNA. 2262 XM_047441925 XM_047441925.1 2656 FHL1 FCMSU; FHL-1; FHL1A; FHL1B; FLH1A; KYOT; RBMX1A; RBMX1B; SLIM; SLIM-1; SLIM1; SLIMMER; XMPMA 2273 RefSeq Homo sapiens (human) PREDICTED: Homo sapiens four and a half LIM domains 1 (FHL1), transcript variant X3, mRNA. 2262 NM_001369331 NM_001369331.1 2236 FHL1 FCMSU; FHL-1; FHL1A; FHL1B; FLH1A; KYOT; RBMX1A; RBMX1B; SLIM; SLIM-1; SLIM1; SLIMMER; XMPMA 2273 RefSeq Homo sapiens (human) Homo sapiens four and a half LIM domains 1 (FHL1), transcript variant 16, mRNA. 1847 NM_001159701 NM_001159701.2 2273 FHL1 FCMSU; FHL-1; FHL1A; FHL1B; FLH1A; KYOT; RBMX1A; RBMX1B; SLIM; SLIM-1; SLIM1; SLIMMER; XMPMA 2273 RefSeq Homo sapiens (human) Homo sapiens four and a half LIM domains 1 (FHL1), transcript variant 5, mRNA. 1884 NM_001159699 NM_001159699.2 2286 FHL1 FCMSU; FHL-1; FHL1A; FHL1B; FLH1A; KYOT; RBMX1A; RBMX1B; SLIM; SLIM-1; SLIM1; SLIMMER; XMPMA 2273 RefSeq Homo sapiens (human) Homo sapiens four and a half LIM domains 1 (FHL1), transcript variant 7, mRNA. 1897 NM_001369330 NM_001369330.1 2298 FHL1 FCMSU; FHL-1; FHL1A; FHL1B; FLH1A; KYOT; RBMX1A; RBMX1B; SLIM; SLIM-1; SLIM1; SLIMMER; XMPMA 2273 RefSeq Homo sapiens (human) Homo sapiens four and a half LIM domains 1 (FHL1), transcript variant 15, mRNA. 1909 XM_054326701 XM_054326701.1 2788 FHL1 FCMSU; FHL-1; FHL1A; FHL1B; FLH1A; KYOT; RBMX1A; RBMX1B; SLIM; SLIM-1; SLIM1; SLIMMER; XMPMA 2273 RefSeq Homo sapiens (human) PREDICTED: Homo sapiens four and a half LIM domains 1 (FHL1), transcript variant X5, mRNA. 2394 XM_047441926 XM_047441926.1 2788 FHL1 FCMSU; FHL-1; FHL1A; FHL1B; FLH1A; KYOT; RBMX1A; RBMX1B; SLIM; SLIM-1; SLIM1; SLIMMER; XMPMA 2273 RefSeq Homo sapiens (human) PREDICTED: Homo sapiens four and a half LIM domains 1 (FHL1), transcript variant X5, mRNA. 2394 NM_001449 NM_001449.5 2368 FHL1 FCMSU; FHL-1; FHL1A; FHL1B; FLH1A; KYOT; RBMX1A; RBMX1B; SLIM; SLIM-1; SLIM1; SLIMMER; XMPMA 2273 RefSeq Homo sapiens (human) Homo sapiens four and a half LIM domains 1 (FHL1), transcript variant 2, mRNA. 1979 NM_001167819 NM_001167819.1 2392 FHL1 FCMSU; FHL-1; FHL1A; FHL1B; FLH1A; KYOT; RBMX1A; RBMX1B; SLIM; SLIM-1; SLIM1; SLIMMER; XMPMA 2273 RefSeq Homo sapiens (human) Homo sapiens four and a half LIM domains 1 (FHL1), transcript variant 9, mRNA. 1980 NM_001159700 NM_001159700.2 2451 FHL1 FCMSU; FHL-1; FHL1A; FHL1B; FLH1A; KYOT; RBMX1A; RBMX1B; SLIM; SLIM-1; SLIM1; SLIMMER; XMPMA 2273 RefSeq Homo sapiens (human) Homo sapiens four and a half LIM domains 1 (FHL1), transcript variant 3, mRNA. 2062 NM_001369329 NM_001369329.1 2499 FHL1 FCMSU; FHL-1; FHL1A; FHL1B; FLH1A; KYOT; RBMX1A; RBMX1B; SLIM; SLIM-1; SLIM1; SLIMMER; XMPMA 2273 RefSeq Homo sapiens (human) Homo sapiens four and a half LIM domains 1 (FHL1), transcript variant 14, mRNA. 2110 NM_001369327 NM_001369327.2 2536 FHL1 FCMSU; FHL-1; FHL1A; FHL1B; FLH1A; KYOT; RBMX1A; RBMX1B; SLIM; SLIM-1; SLIM1; SLIMMER; XMPMA 2273 RefSeq Homo sapiens (human) Homo sapiens four and a half LIM domains 1 (FHL1), transcript variant 12, mRNA. 2147 NM_001159702 NM_001159702.3 2568 FHL1 FCMSU; FHL-1; FHL1A; FHL1B; FLH1A; KYOT; RBMX1A; RBMX1B; SLIM; SLIM-1; SLIM1; SLIMMER; XMPMA 2273 RefSeq Homo sapiens (human) Homo sapiens four and a half LIM domains 1 (FHL1), transcript variant 1, mRNA. 2179 NM_001369328 NM_001369328.1 2576 FHL1 FCMSU; FHL-1; FHL1A; FHL1B; FLH1A; KYOT; RBMX1A; RBMX1B; SLIM; SLIM-1; SLIM1; SLIMMER; XMPMA 2273 RefSeq Homo sapiens (human) Homo sapiens four and a half LIM domains 1 (FHL1), transcript variant 13, mRNA. 2187 NM_001369326 NM_001369326.1 2699 FHL1 FCMSU; FHL-1; FHL1A; FHL1B; FLH1A; KYOT; RBMX1A; RBMX1B; SLIM; SLIM-1; SLIM1; SLIMMER; XMPMA 2273 RefSeq Homo sapiens (human) Homo sapiens four and a half LIM domains 1 (FHL1), transcript variant 11, mRNA. 2310 NM_001159704 NM_001159704.1 2906 FHL1 FCMSU; FHL-1; FHL1A; FHL1B; FLH1A; KYOT; RBMX1A; RBMX1B; SLIM; SLIM-1; SLIM1; SLIMMER; XMPMA 2273 RefSeq Homo sapiens (human) Homo sapiens four and a half LIM domains 1 (FHL1), transcript variant 4, mRNA. 2494