# [ GGRNA.v2 | 2024-05-03 00:21:32 ] # # seq:AGGGTAGAGCCACAAATTTCAATTC 8 # [INTERSECTION] 8 # # accession version gi length symbol synonym geneid division source definition nt_position aa_position NM_001159597 NM_001159597.3 1687 SH3YL1 RAY 26751 RefSeq Homo sapiens (human) Homo sapiens SH3 and SYLF domain containing 1 (SH3YL1), transcript variant 2, mRNA. 1347 NM_015677 NM_015677.4 1744 SH3YL1 RAY 26751 RefSeq Homo sapiens (human) Homo sapiens SH3 and SYLF domain containing 1 (SH3YL1), transcript variant 1, mRNA. 1404 NM_001282682 NM_001282682.2 1815 SH3YL1 RAY 26751 RefSeq Homo sapiens (human) Homo sapiens SH3 and SYLF domain containing 1 (SH3YL1), transcript variant 3, mRNA. 1475 NM_001282687 NM_001282687.2 1963 SH3YL1 RAY 26751 RefSeq Homo sapiens (human) Homo sapiens SH3 and SYLF domain containing 1 (SH3YL1), transcript variant 4, mRNA. 1623 NR_104225 NR_104225.1 2025 SH3YL1 RAY 26751 RefSeq Homo sapiens (human) Homo sapiens SH3 and SYLF domain containing 1 (SH3YL1), transcript variant 7, non-coding RNA. 1660 NR_104226 NR_104226.1 2497 SH3YL1 RAY 26751 RefSeq Homo sapiens (human) Homo sapiens SH3 and SYLF domain containing 1 (SH3YL1), transcript variant 8, non-coding RNA. 2132 NR_104227 NR_104227.1 3319 SH3YL1 RAY 26751 RefSeq Homo sapiens (human) Homo sapiens SH3 and SYLF domain containing 1 (SH3YL1), transcript variant 9, non-coding RNA. 2954 NR_104223 NR_104223.2 3368 SH3YL1 RAY 26751 RefSeq Homo sapiens (human) Homo sapiens SH3 and SYLF domain containing 1 (SH3YL1), transcript variant 5, non-coding RNA. 3028