LOCUS       NR_039608                 54 bp    RNA     linear   PRI 03-OCT-2021
DEFINITION  Homo sapiens microRNA 378d-1 (MIR378D1), microRNA.
ACCESSION   NR_039608
VERSION     NR_039608.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 54)
  AUTHORS   Chen Q, Li Z, Xu Z, Chen C, Wang J, Zhu J and Dong Z.
  TITLE     miR-378d is Involved in the Regulation of Apoptosis and Autophagy
            of and E2 Secretion from Cultured Ovarian Granular Cells Treated by
            Sodium Fluoride
  JOURNAL   Biol Trace Elem Res 199 (11), 4119-4128 (2021)
   PUBMED   33405077
  REMARK    GeneRIF: miR-378d is Involved in the Regulation of Apoptosis and
            Autophagy of and E2 Secretion from Cultured Ovarian Granular Cells
            Treated by Sodium Fluoride.
REFERENCE   2  (bases 1 to 54)
  AUTHORS   Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi
            S, Kawano M, Matsushita S, Ochiya T and Miyajima A.
  TITLE     Identification of the novel 3' UTR sequences of human IL-21 mRNA as
            potential targets of miRNAs
  JOURNAL   Sci Rep 7 (1), 7780 (2017)
   PUBMED   28798470
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 54)
  AUTHORS   Kozomara A and Griffiths-Jones S.
  TITLE     miRBase: integrating microRNA annotation and deep-sequencing data
  JOURNAL   Nucleic Acids Res 39 (Database issue), D152-D157 (2011)
   PUBMED   21037258
REFERENCE   4  (bases 1 to 54)
  AUTHORS   Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY,
            Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP,
            Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI,
            Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Liu Q,
            How T, Grubor V, Gao Y, Patel A, Wu H, Zhu J, Blobe GC, Lipsky PE,
            Chadburn A and Dave SS.
  CONSRTM   Hematologic Malignancies Research Consortium
  TITLE     Deep sequencing of the small RNA transcriptome of normal and
            malignant human B cells identifies hundreds of novel microRNAs
  JOURNAL   Blood 116 (23), e118-e127 (2010)
   PUBMED   20733160
REFERENCE   5  (bases 1 to 54)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AC092442.5.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            ##Evidence-Data-START##
            Transcript is intronless :: LM611275.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-54                AC092442.5         6992-7045           c
FEATURES             Location/Qualifiers
     source          1..54
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="4"
                     /map="4p16.2"
     gene            1..54
                     /gene="MIR378D1"
                     /gene_synonym="mir-378d-1"
                     /note="microRNA 378d-1"
                     /db_xref="GeneID:100616201"
                     /db_xref="HGNC:HGNC:41550"
                     /db_xref="miRBase:MI0016749"
     precursor_RNA   1..54
                     /gene="MIR378D1"
                     /gene_synonym="mir-378d-1"
                     /product="microRNA 378d-1"
                     /db_xref="GeneID:100616201"
                     /db_xref="HGNC:HGNC:41550"
                     /db_xref="miRBase:MI0016749"
     exon            1..54
                     /gene="MIR378D1"
                     /gene_synonym="mir-378d-1"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="MIR378D1"
                     /gene_synonym="mir-378d-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1350266661"
     variation       2
                     /gene="MIR378D1"
                     /gene_synonym="mir-378d-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:28645567"
     variation       3
                     /gene="MIR378D1"
                     /gene_synonym="mir-378d-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:990958206"
     variation       4
                     /gene="MIR378D1"
                     /gene_synonym="mir-378d-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1717364372"
     variation       5
                     /gene="MIR378D1"
                     /gene_synonym="mir-378d-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1717364182"
     variation       9
                     /gene="MIR378D1"
                     /gene_synonym="mir-378d-1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1577891645"
     variation       14..15
                     /gene="MIR378D1"
                     /gene_synonym="mir-378d-1"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1717363847"
     variation       15
                     /gene="MIR378D1"
                     /gene_synonym="mir-378d-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:958209445"
     variation       17..21
                     /gene="MIR378D1"
                     /gene_synonym="mir-378d-1"
                     /replace="tt"
                     /replace="ttctt"
                     /db_xref="dbSNP:2474207122"
     variation       17
                     /gene="MIR378D1"
                     /gene_synonym="mir-378d-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:926751644"
     variation       20..27
                     /gene="MIR378D1"
                     /gene_synonym="mir-378d-1"
                     /replace="ttgtt"
                     /replace="ttgttgtt"
                     /db_xref="dbSNP:879129710"
     variation       21
                     /gene="MIR378D1"
                     /gene_synonym="mir-378d-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1216801295"
     variation       24
                     /gene="MIR378D1"
                     /gene_synonym="mir-378d-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1717363095"
     variation       25
                     /gene="MIR378D1"
                     /gene_synonym="mir-378d-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2108739564"
     ncRNA           31..50
                     /ncRNA_class="miRNA"
                     /gene="MIR378D1"
                     /gene_synonym="mir-378d-1"
                     /product="hsa-miR-378d"
                     /db_xref="miRBase:MIMAT0018926"
                     /db_xref="GeneID:100616201"
                     /db_xref="HGNC:HGNC:41550"
                     /db_xref="miRBase:MI0016749"
     variation       33
                     /gene="MIR378D1"
                     /gene_synonym="mir-378d-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2474207112"
     variation       34
                     /gene="MIR378D1"
                     /gene_synonym="mir-378d-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1344067493"
     variation       36
                     /gene="MIR378D1"
                     /gene_synonym="mir-378d-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1302915342"
     variation       37
                     /gene="MIR378D1"
                     /gene_synonym="mir-378d-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1032722477"
     variation       38
                     /gene="MIR378D1"
                     /gene_synonym="mir-378d-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1717362467"
     variation       42
                     /gene="MIR378D1"
                     /gene_synonym="mir-378d-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1215256756"
     variation       51
                     /gene="MIR378D1"
                     /gene_synonym="mir-378d-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:949624071"
     variation       53
                     /gene="MIR378D1"
                     /gene_synonym="mir-378d-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1189859928"
ORIGIN      

actgtttctgtccttgttcttgttgttattactggacttggagtcagaaacagg

//