LOCUS       XR_007069599             961 bp    RNA     linear   PRI 05-OCT-2023
DEFINITION  PREDICTED: Homo sapiens testis-specific Y-encoded protein 4-like
            (LOC124905613), transcript variant X4, misc_RNA.
ACCESSION   XR_007069599
VERSION     XR_007069599.1
DBLINK      BioProject: PRJNA168
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_025791821) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_000001405.40-RS_2023_10
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           RefSeqFE; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 10/02/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..961
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="Y"
                     /map="Yp11.2"
     gene            1..961
                     /gene="LOC124905613"
                     /note="testis-specific Y-encoded protein 4-like; Derived
                     by automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 1 EST, and 98% coverage of the annotated genomic
                     feature by RNAseq alignments, including 7 samples with
                     support for all annotated introns"
                     /db_xref="GeneID:124905613"
     misc_RNA        1..961
                     /gene="LOC124905613"
                     /product="testis-specific Y-encoded protein 4-like,
                     transcript variant X4"
                     /db_xref="GeneID:124905613"
ORIGIN      

gcctggaagcccggcgcatgcgccctgagggctcgctgacctaccgggtgccagagaggctgcggcagggtttctgtggcgtgggtcgggcagcacaggccttggtgtgtgcgagtgccaaggagggcaccgccttcaggatggaggctgtacaggagggggcggccggggtggagagtgagcaggcggctttgggggaggaggcggtgctgctgttggatgacataatggcggaggtggaggtggtggcggaggtggaggtggtggcggaggaggagggcctcgtggagcggcgggaggaggcccagcgggcacagcaggctgtgcctggccctgggcccatgaccccagagtctgcactggaggagctgctggccgttcaggtggagctggagccggttaatgcccaagccaggaaggccttttctcggcagcgggaaaagatggagcggaggcgcaagccccacctagaccgcagaggcgccgtcatccagagcgtccctggcttctgggccaatgttattgcaaaccacccccagatgtcagccctgatcactgacgaagatgaagacatgctgagctacatggtcagcctggaggtgggagaagagaagcatcctgttcatctctgcaagatcatgttgttctttcggagtaacccctacttccagaataaagtgattaccaaggaatatctggtgaacatcacagggcttctcattccactccaattgagtggtatccggattatgaagtggaggcctatcgccgcagacaccacaacagcagccttaacttcttcaactggttctctgaccacaacttcgcaggatctaacaagattgctgagtcccctgacagatcctatgtaaggacctgtggcgcaatcccctgcaatactacaagaggatgaagccacctgaagagggaacagagacgtcaggggactcccagttgttga

//