2024-05-06 15:57:06, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_054363527 1468 bp mRNA linear PRI 05-OCT-2023 DEFINITION PREDICTED: Homo sapiens Zn regulated GTPase metalloprotein activator 1F (ZNG1F), transcript variant X6, mRNA. ACCESSION XM_054363527 VERSION XM_054363527.1 DBLINK BioProject: PRJNA807723 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_060933) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Updated annotation Annotation Name :: GCF_009914755.1-RS_2023_10 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.2 Annotation Method :: Best-placed RefSeq; Gnomon; RefSeqFE; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 10/02/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1468 /organism="Homo sapiens" /mol_type="mRNA" /isolate="CHM13" /db_xref="taxon:9606" /chromosome="9" /sex="female" /cell_line="CHM13htert" /tissue_type="hydatidiform mole" /note="haploid cell line" gene 1..1468 /gene="ZNG1F" /gene_synonym="CBWD6; CBWD7" /note="Zn regulated GTPase metalloprotein activator 1F; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 34 ESTs, 279 long SRA reads, 2 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 117 samples with support for all annotated introns" /db_xref="GeneID:644019" /db_xref="HGNC:HGNC:31978" CDS 60..1043 /gene="ZNG1F" /gene_synonym="CBWD6; CBWD7" /codon_start=1 /product="zinc-regulated GTPase metalloprotein activator 1F isoform X6" /protein_id="XP_054219502.1" /db_xref="GeneID:644019" /db_xref="HGNC:HGNC:31978" /translation="
MLPAVGSVDEEEDPAEEDCPELVPIETTQSEEEEKSGLGAKIPVTIITGYLGAGKTTLLNYILTEQHSKRVAVILNESGEGSALEKSLAVSQGGELYEEWLELRNGCLCCSVKDNGLRAIENLMQKKGKFDDILLETTGLADPGIITIVDSKYGLKHLTEEKPDGLINEATRSINGLGQILETQRSSLQKKLQHVPGTQPHLDQSIVTITFDVPGNAKEEHLNMFIQNLLWEKNVRNKDNHCMEVIRLKGLVSIKDKSQQVIVQGVHELCDLEETPVSWKDDTERTNRLVLIGRNLDKDILKQLFIATVTETEKQWTTHFKEDQVCT"
misc_feature <114..>245 /gene="ZNG1F" /gene_synonym="CBWD6; CBWD7" /note="Predicted ATPase of the ABC class [General function prediction only]; Region: COG3044" /db_xref="CDD:225586" misc_feature 186..617 /gene="ZNG1F" /gene_synonym="CBWD6; CBWD7" /note="cobalamin synthesis protein CobW; Region: CobW-like; cd03112" /db_xref="CDD:349766" misc_feature order(213..230,465..467,543..545) /gene="ZNG1F" /gene_synonym="CBWD6; CBWD7" /note="putative active site [active]" /db_xref="CDD:349766" misc_feature order(282..284,297..299,384..386) /gene="ZNG1F" /gene_synonym="CBWD6; CBWD7" /note="Zn binding site [ion binding]; other site" /db_xref="CDD:349766" misc_feature 675..974 /gene="ZNG1F" /gene_synonym="CBWD6; CBWD7" /note="Cobalamin synthesis protein cobW C-terminal domain; Region: CobW_C; pfam07683" /db_xref="CDD:429593" ORIGIN
gcggtacggcgtgttggtcccagcggttcagctgaggtagggacgtgctgtaggccggaatgttaccggctgttggatctgtggatgaggaagaggatcctgcggaggaggattgtcctgaattggttcccattgagacgacgcaaagcgaggaggaggaaaagtctggcctcggcgccaagatcccagtcacaattatcaccgggtatttaggtgctgggaagacaacacttctgaactatattttgacagagcaacatagtaaaagagtagcggtcattttaaatgaatctggggaaggaagtgcgctggagaaatccttagctgtcagccaaggtggagagctctatgaagagtggctggaacttagaaacggttgcctctgctgttcagtgaaggacaatggccttagagctattgagaatttgatgcaaaagaaggggaaatttgatgacatactgttagagaccactggattagcagaccctggtatcataactattgtggattcaaaatatggattaaaacatttaacagaagagaaacctgatggccttatcaatgaagctactagatccataaatggactaggacaaatcttagaaacacaaagatcaagtttgcagaaaaaacttcagcatgtgccaggaacacaacctcaccttgatcagagtattgttacaatcacatttgacgtaccaggaaatgcaaaggaagaacatcttaatatgtttattcagaatcttctgtgggaaaagaatgtgagaaacaaggacaatcactgcatggaggtcataaggctgaagggattggtgtcaatcaaagacaaatcacaacaagtgattgtccagggtgtccatgagctctgtgatctggaggagactccagtgagctggaaggatgacactgagagaacaaatcgattggtcctcattggcagaaatttagataaggatatccttaaacagctgtttatagctactgtgacagaaacagaaaagcagtggacaacacatttcaaagaagatcaagtttgtacataacactagaggcatttcttatcaaaaggattggataataaaaataagtttctactgggtatatttcaagcatttatttattactttagttacgaattccaatatactttaaaatggtatttgttttacagcatacataaaatgtagcaaatcagtactgtaaaacatttaacattcatacaattatatataatatccttttttttaaagaatggtatttcacaaaaatatcttttgaaattggctttggagtttacatatactgaacatgaaagtttataataatgatgatacaactttcaacattgtcattttttcttagaacttcagctgattgcagagatataatgattacattgttattaaatttttttaacacaagtaagtgtcaccattttatgacatgaaataaaaggttatgactgtta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]