LOCUS       XM_054355957            2378 bp    mRNA    linear   PRI 05-OCT-2023
DEFINITION  PREDICTED: Homo sapiens arginyl-tRNA synthetase 2, mitochondrial
            (RARS2), transcript variant X1, mRNA.
ACCESSION   XM_054355957
VERSION     XM_054355957.1
DBLINK      BioProject: PRJNA807723
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_060930) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_009914755.1-RS_2023_10
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           RefSeqFE; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 10/02/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2378
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /isolate="CHM13"
                     /db_xref="taxon:9606"
                     /chromosome="6"
                     /sex="female"
                     /cell_line="CHM13htert"
                     /tissue_type="hydatidiform mole"
                     /note="haploid cell line"
     gene            1..2378
                     /gene="RARS2"
                     /gene_synonym="ArgRS; DALRD2; PCH6; PRO1992; RARSL"
                     /note="arginyl-tRNA synthetase 2, mitochondrial; Derived
                     by automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 38 ESTs, 231 long SRA reads, and 100% coverage of the
                     annotated genomic feature by RNAseq alignments, including
                     71 samples with support for all annotated introns"
                     /db_xref="GeneID:57038"
                     /db_xref="HGNC:HGNC:21406"
                     /db_xref="MIM:611524"
     CDS             31..1539
                     /gene="RARS2"
                     /gene_synonym="ArgRS; DALRD2; PCH6; PRO1992; RARSL"
                     /codon_start=1
                     /product="probable arginine--tRNA ligase, mitochondrial
                     isoform X1"
                     /protein_id="XP_054211932.1"
                     /db_xref="GeneID:57038"
                     /db_xref="HGNC:HGNC:21406"
                     /db_xref="MIM:611524"
                     /translation="

MACGFRRAIACQLSRVLNLPPENLITSISAVPISQKEEVADFQLSVDSLLEKDNDHSRPDIQVQAKRLAEKLRCDTVVSEISTGQRTVNFKINRELLTKTVLQQVIEDGSKYGLKSELFSGLPQKKIVVEFSSPNVAKKFHVGHLRSTIIGNFIANLKEALGHQVIRINYLGDWGMQFGLLGTGFQLFGYEEKLQSNPLQHLFEVYVQVNKEAADDKSVAKAAQEFFQRLELGDVQALSLWQKFRDLSIEEYIRVYKRLGVYFDEYSGESFYREKSQEVLKLLESKGLLLRTIKGTAVVDLSGNGDPSSICTVMRSDGTSLYATRDLAAAIDRMDKYNFDTMIYVTDKGQKKHFQQVFQMLKIMGYDWAERCQHVPFGVVQGMKTRRGDVTFLEDVLNEIQLRMLQNMASIKTTKELKNPQETAERVGLAALIIQDFKGLLLSDYKFSWDRVFQSRGDTGVFLQYTHARLHRDHQVCFCLSKWLLAFLLPSRVNSPVAAFCL"

     misc_feature    136..1443
                     /gene="RARS2"
                     /gene_synonym="ArgRS; DALRD2; PCH6; PRO1992; RARSL"
                     /note="Arginyl-tRNA synthetase [Translation, ribosomal
                     structure and biogenesis]; Region: ArgS; COG0018"
                     /db_xref="CDD:223097"
ORIGIN      

ggactgcggcgcacttccgtagaggtggacatggcgtgcggctttcgccgcgctattgcttgccagctttccagagtgttgaatcttccaccagaaaacttgatcacatcaatatctgcagttccaatttcccaaaaagaagaagtagctgattttcagctttctgtggattctttattggaaaaagacaatgaccattcaagaccagatattcaagttcaagccaagagactagcagagaagctaagatgtgatacagtggtgagtgaaatcagtactggtcaaaggactgtaaatttcaaaataaacagagagctcttaacaaagacagtgctacaacaagtaattgaagatggctcaaaatatggattaaaaagtgaacttttctctggacttccccagaagaagattgtggttgaattcagttcacctaatgttgccaaaaaatttcatgttggacatttgcgttctaccatcataggaaattttatagcaaatctcaaagaagctttaggacatcaagtaataagaataaattaccttggcgattggggcatgcagtttggtcttctgggaactggcttccagctgtttggctatgaggaaaaactgcagtccaatcctctacagcatctctttgaagtttatgtacaagttaataaagaagcagcagatgataaaagtgtagcaaaagcagcacaggagttcttccaacgattggaactgggcgatgtgcaagcactttcactgtggcaaaaatttcgggacttgagcattgaagagtacattcgggtttacaagcgtctgggagtatattttgatgaatattcaggagaatcattttatcgtgaaaaatctcaagaggtcttaaagttgctggagagtaaaggactcctactgagaacaataaaaggaacggctgtagtagatctctctgggaatggcgacccctcctcaatttgtactgtaatgcgaagtgatgggacttctctctatgcaaccagagatcttgcagctgctatagatcgaatggacaagtataattttgatacaatgatatatgtgacagataaaggacaaaaaaagcattttcagcaagtattccaaatgctgaagatcatgggatatgactgggcagaaaggtgccagcacgtgccctttggagtagtacagggaatgaagactcgaagaggagatgtcactttcctggaagatgttttaaatgagattcaattaaggatgctacagaacatggcttcaattaagacaactaaagaactcaagaacccacaagagactgcagagagggtcgggctcgcagcactcattattcaggacttcaaaggtttactcttatctgactacaagttcagctgggatcgtgttttccagagtcgcggggacacaggagtcttcctacagtacacacacgcccgcctccacagggatcatcaagtgtgcttctgcttatcaaaatggctattagcatttttgctgcccagtagagtcaacagtccagtagctgccttctgcctctagacttttcccaaaggtatgccttaaaaagtgattatttgcattttgaggacagagggcatagattaagccaatgcccaaggaggacagtctttgggtcttcagaatattatcactgatgaatagcgcacatgtctagctgcctctagctcacataaagccttataaaagcataaccttttttagttttagtttgagaaagagcatcttcttgctctctgtggtaagtgaaggaaaatacctgcctttgtgcagcttcccagagaccgtaagtccttcatttgcctcttggtttcggttcacaatctcaaatacatatatgtatgtgatgctcccatgctaggcaagacacccacacattttagctctgacgggcattgttggtgaagccaaacatgccagagattagtctctagaagggatgtggatggttatgaacaaggtggttttctttgattgccatatagtagtcagtggttctttcctggaatcagaaaaatttactcacatgtacaatagggaatgtacggaaaaataagccaactgggttttcttagcattgagggtagactttgctaatttatattttatattcttaaacatggctggaggctttttacattcaccagccatgatttaagtttttgctgtggactaggtctaggaaatagcaagatgatttagaaagtccctgccatcaaagaatttggaagaaagaaaaatgttcctttgccttcaaatgtacacacagttttttcatatccttctactcttctttttttttgagacggagtcttgctctgttgcccaggctagagtacagtggctggatctcggctcac

//