2024-04-28 05:47:00, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_054321051 1576 bp mRNA linear PRI 05-OCT-2023 DEFINITION PREDICTED: Homo sapiens pregnancy specific beta-1-glycoprotein 8 (PSG8), transcript variant X3, mRNA. ACCESSION XM_054321051 VERSION XM_054321051.1 DBLINK BioProject: PRJNA807723 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_060943) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Updated annotation Annotation Name :: GCF_009914755.1-RS_2023_10 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.2 Annotation Method :: Best-placed RefSeq; Gnomon; RefSeqFE; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 10/02/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1576 /organism="Homo sapiens" /mol_type="mRNA" /isolate="CHM13" /db_xref="taxon:9606" /chromosome="19" /sex="female" /cell_line="CHM13htert" /tissue_type="hydatidiform mole" /note="haploid cell line" gene 1..1576 /gene="PSG8" /gene_synonym="PSG1" /note="pregnancy specific beta-1-glycoprotein 8; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs, 8 long SRA reads, 4 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 5 samples with support for all annotated introns" /db_xref="GeneID:440533" /db_xref="HGNC:HGNC:9525" /db_xref="MIM:176397" CDS 126..902 /gene="PSG8" /gene_synonym="PSG1" /codon_start=1 /product="pregnancy-specific beta-1-glycoprotein 8 isoform X3" /protein_id="XP_054177026.1" /db_xref="GeneID:440533" /db_xref="HGNC:HGNC:9525" /db_xref="MIM:176397" /translation="
MEAVSLTCDPETPDASYLWWMNGQSLPMSHRLQLSETNRTLFLLGVTKYTAGPYECEIRNPVSASRSDPFTLNLLPKLPKPYITINNLKPRENKDVLNFTCEPKSENYTYIWWLNGQSLPVSPRVKRPIENRILILPSVTRNETGPYQCEIRDQYGGIRSYPVTLNVLYGPDLPRIYPSFTYYRSGEVLYLSCSADSNPPAQYSWTINGKFQLSGQKLFIPQITTKHSGLYACSVRNSATGKESSKSMTVKVSDWTLP"
misc_feature 126..350 /gene="PSG8" /gene_synonym="PSG1" /note="Immunoglobulin (Ig)-like domain of human carcinoembryonic antigen (CEA) related cell adhesion molecule (CEACAM) domains 2, 4, and 6, and similar domains; Region: IgI_hCEACAM_2_4_6_like; cd05740" /db_xref="CDD:409402" misc_feature 135..155 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409402" misc_feature 174..191 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409402" misc_feature 195..206 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand C' [structural motif]; Region: Ig strand C'" /db_xref="CDD:409402" misc_feature 216..230 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand D [structural motif]; Region: Ig strand D" /db_xref="CDD:409402" misc_feature 237..254 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409402" misc_feature 282..308 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409402" misc_feature 318..347 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409402" misc_feature 363..629 /gene="PSG8" /gene_synonym="PSG1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 414..428 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 453..467 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 519..533 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 561..578 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 606..617 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 654..881 /gene="PSG8" /gene_synonym="PSG1" /note="Fifth immunoglobulin (Ig)-like domain of the carcinoembryonic antigen (CEA) related cell adhesion molecule 5 (CEACAM5) and similar domains; member of the C2-set IgSF domains; Region: IgC2_CEACAM5-like; cd20948" /db_xref="CDD:409540" misc_feature 654..674 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand A [structural motif]; Region: Ig strand A" /db_xref="CDD:409540" misc_feature 687..710 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409540" misc_feature 726..746 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409540" misc_feature 753..770 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand C' [structural motif]; Region: Ig strand C'" /db_xref="CDD:409540" misc_feature 777..797 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409540" misc_feature 804..839 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409540" misc_feature 846..881 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409540" ORIGIN
taccttgggcggcaaagtaagactgaaactaagaagattccagcactgcatgctccaagtgaggaccacaagtggagactcccaagccctccatctccagcagcaaattaaaccccagggaggccatggaggctgtgagcttaacctgtgatcctgagactccggacgcaagctacctgtggtggatgaatggtcagagcctccctatgtctcacaggttgcagttgtctgaaaccaacaggaccctctttctattgggtgtcacaaagtacactgcaggaccctatgaatgtgaaatacggaacccagtgagtgccagccgcagtgacccattcaccctgaatctcctcccgaagctgcccaagccctacatcaccatcaacaacttaaaacccagggagaataaggatgtcttaaacttcacctgtgaacctaagagtgagaactacacctacatttggtggctaaatggtcagagcctcccggtcagtcccagggtaaagcgacccattgaaaacaggatcctcattctacccagtgtcacgagaaatgaaacaggaccctatcaatgtgaaataagggaccaatatggtggcatccgcagttacccagtcaccctgaatgtcctctatggtccagacctccccagaatttacccttcattcacctattaccgttcaggagaagtcctctacttgtcctgttctgcggactctaacccaccggcacagtattcttggacaattaatgggaagtttcagctatcaggacaaaagctctttatcccccaaattactacaaagcatagcgggctctatgcttgctctgttcgtaactcagccactggcaaggaaagctccaaatccatgacagtaaaagtctctgactggacattaccctgaattctactagttcctccaattccattttcttccatggaatcgctaagaaaaagacccactctgttccagaagccctataagctggaggtggacaactcaatgtaaatttcatgggaaaacccttgtacctgaagcgtgagccactcagaactcactaaaatgttcgacaccataacaacagatgctcaaactgtaaaccaggacaacaagtggatgacttcacactgtggacagtttttcccaagatgtcagaacaagactccccatcatgatgaggctctcacccctcttaactgtccttgctcatgcctgcctctttcacttggcaggataatgcagtcattagaatttcacatgtagtagcttctgagggtaacaatagagtgtcagatatgtcatctcaacccaaacttttacataacatctcagggggaaatgtggctctctccaccttgcatacaggactcccaatagaaatgaacacagagatattgcccgtgtgtttgcagataagatggtttctatgaagaggtaggaaagctgaaattataatagagtcccctttaaatgcacattctgtggatggctctcgccatttcctaagagatacattgtaaaatgtgacagtaatactgattctagcagaataaaacatgtaccacatttgctaatac
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]