2024-04-28 06:09:22, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_054321049 1752 bp mRNA linear PRI 05-OCT-2023 DEFINITION PREDICTED: Homo sapiens pregnancy specific beta-1-glycoprotein 8 (PSG8), transcript variant X1, mRNA. ACCESSION XM_054321049 VERSION XM_054321049.1 DBLINK BioProject: PRJNA807723 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_060943) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Updated annotation Annotation Name :: GCF_009914755.1-RS_2023_10 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.2 Annotation Method :: Best-placed RefSeq; Gnomon; RefSeqFE; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 10/02/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1752 /organism="Homo sapiens" /mol_type="mRNA" /isolate="CHM13" /db_xref="taxon:9606" /chromosome="19" /sex="female" /cell_line="CHM13htert" /tissue_type="hydatidiform mole" /note="haploid cell line" gene 1..1752 /gene="PSG8" /gene_synonym="PSG1" /note="pregnancy specific beta-1-glycoprotein 8; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs, 9 long SRA reads, 3 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 4 samples with support for all annotated introns" /db_xref="GeneID:440533" /db_xref="HGNC:HGNC:9525" /db_xref="MIM:176397" CDS 98..1078 /gene="PSG8" /gene_synonym="PSG1" /codon_start=1 /product="pregnancy-specific beta-1-glycoprotein 8 isoform X1" /protein_id="XP_054177024.1" /db_xref="GeneID:440533" /db_xref="HGNC:HGNC:9525" /db_xref="MIM:176397" /translation="
MGLLSAPPCTQRITWKGLLLTASLLNFWNPPTTAQVTIEAQPTKVSEGKDVLLLVHNLPQNLTGYIWYKGQIRDLYHYITSYVVDGQIIIYGPAYSGRETIYSNASLLIQNVTQEDAGSYTLHIIMGGDENRGVTGHFTFTLYLETPKPSISSSKLNPREAMEAVSLTCDPETPDASYLWWMNGQSLPMSHRLQLSETNRTLFLLGVTKYTAGPYECEIRNPVSASRSDPFTLNLLHGPDLPRIYPSFTYYRSGEVLYLSCSADSNPPAQYSWTINGKFQLSGQKLFIPQITTKHSGLYACSVRNSATGKESSKSMTVKVSDWTLP"
misc_feature 203..472 /gene="PSG8" /gene_synonym="PSG1" /note="First immunoglobulin (Ig)-like domain of carcinoembryonic antigen (CEA) related cell adhesion molecule (CEACAM); Region: IgV_CEACAM_D1; cd05774" /db_xref="CDD:409430" misc_feature 206..262 /gene="PSG8" /gene_synonym="PSG1" /note="FR1 [structural motif]; Region: FR1" /db_xref="CDD:409430" misc_feature 206..214 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand A [structural motif]; Region: Ig strand A" /db_xref="CDD:409430" misc_feature 227..235 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand A' [structural motif]; Region: Ig strand A'" /db_xref="CDD:409430" misc_feature 242..265 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409430" misc_feature 263..286 /gene="PSG8" /gene_synonym="PSG1" /note="CDR1 [structural motif]; Region: CDR1" /db_xref="CDD:409430" misc_feature 287..304 /gene="PSG8" /gene_synonym="PSG1" /note="FR2 [structural motif]; Region: FR2" /db_xref="CDD:409430" misc_feature 287..301 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409430" misc_feature 305..370 /gene="PSG8" /gene_synonym="PSG1" /note="CDR2 [structural motif]; Region: CDR2" /db_xref="CDD:409430" misc_feature 329..346 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand C' [structural motif]; Region: Ig strand C'" /db_xref="CDD:409430" misc_feature 359..370 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand C' [structural motif]; Region: Ig strand C'" /db_xref="CDD:409430" misc_feature 389..469 /gene="PSG8" /gene_synonym="PSG1" /note="FR3 [structural motif]; Region: FR3" /db_xref="CDD:409430" misc_feature 389..406 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand D [structural motif]; Region: Ig strand D" /db_xref="CDD:409430" misc_feature 410..424 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409430" misc_feature <416..535 /gene="PSG8" /gene_synonym="PSG1" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 452..469 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409430" misc_feature 452..469 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 512..523 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 539..805 /gene="PSG8" /gene_synonym="PSG1" /note="Immunoglobulin (Ig)-like domain of human carcinoembryonic antigen (CEA) related cell adhesion molecule (CEACAM) domains 2, 4, and 6, and similar domains; Region: IgI_hCEACAM_2_4_6_like; cd05740" /db_xref="CDD:409402" misc_feature 539..553 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand A [structural motif]; Region: Ig strand A" /db_xref="CDD:409402" misc_feature 560..577 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand A' [structural motif]; Region: Ig strand A'" /db_xref="CDD:409402" misc_feature 590..610 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409402" misc_feature 629..646 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409402" misc_feature 650..661 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand C' [structural motif]; Region: Ig strand C'" /db_xref="CDD:409402" misc_feature 671..685 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand D [structural motif]; Region: Ig strand D" /db_xref="CDD:409402" misc_feature 692..709 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409402" misc_feature 737..763 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409402" misc_feature 773..802 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409402" misc_feature 830..1057 /gene="PSG8" /gene_synonym="PSG1" /note="Fifth immunoglobulin (Ig)-like domain of the carcinoembryonic antigen (CEA) related cell adhesion molecule 5 (CEACAM5) and similar domains; member of the C2-set IgSF domains; Region: IgC2_CEACAM5-like; cd20948" /db_xref="CDD:409540" misc_feature 830..850 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand A [structural motif]; Region: Ig strand A" /db_xref="CDD:409540" misc_feature 863..886 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409540" misc_feature 902..922 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409540" misc_feature 929..946 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand C' [structural motif]; Region: Ig strand C'" /db_xref="CDD:409540" misc_feature 953..973 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409540" misc_feature 980..1015 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409540" misc_feature 1022..1057 /gene="PSG8" /gene_synonym="PSG1" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409540" ORIGIN
agaaggaggcaggacagcactgctgagagctgtgctcaggaagcttctggatcctaggctcatctccacagaggagaacacacagacagcagagaccatggggctcctctcagcccctccctgcacacagcgcatcacctggaaggggctcctgctcacagcatcacttttaaacttctggaacccacccacgactgcccaagtcacgattgaagcccagccaaccaaagtttctgaggggaaggatgttcttctacttgtccacaatttgccccagaatcttactggctacatctggtacaaagggcaaatcagggacctctaccattacattacatcatatgtagtagacggtcaaataattatatatgggcctgcatacagtggacgagaaacaatatattccaatgcatccctgctgatccagaatgtcacccaggaagacgcaggatcctacaccttacacatcataatgggaggtgatgagaatagaggagtaactggacatttcaccttcaccttatatctggagactcccaagccctccatctccagcagcaaattaaaccccagggaggccatggaggctgtgagcttaacctgtgatcctgagactccggacgcaagctacctgtggtggatgaatggtcagagcctccctatgtctcacaggttgcagttgtctgaaaccaacaggaccctctttctattgggtgtcacaaagtacactgcaggaccctatgaatgtgaaatacggaacccagtgagtgccagccgcagtgacccattcaccctgaatctcctccatggtccagacctccccagaatttacccttcattcacctattaccgttcaggagaagtcctctacttgtcctgttctgcggactctaacccaccggcacagtattcttggacaattaatgggaagtttcagctatcaggacaaaagctctttatcccccaaattactacaaagcatagcgggctctatgcttgctctgttcgtaactcagccactggcaaggaaagctccaaatccatgacagtaaaagtctctgactggacattaccctgaattctactagttcctccaattccattttcttccatggaatcgctaagaaaaagacccactctgttccagaagccctataagctggaggtggacaactcaatgtaaatttcatgggaaaacccttgtacctgaagcgtgagccactcagaactcactaaaatgttcgacaccataacaacagatgctcaaactgtaaaccaggacaacaagtggatgacttcacactgtggacagtttttcccaagatgtcagaacaagactccccatcatgatgaggctctcacccctcttaactgtccttgctcatgcctgcctctttcacttggcaggataatgcagtcattagaatttcacatgtagtagcttctgagggtaacaatagagtgtcagatatgtcatctcaacccaaacttttacataacatctcagggggaaatgtggctctctccaccttgcatacaggactcccaatagaaatgaacacagagatattgcccgtgtgtttgcagataagatggtttctatgaagaggtaggaaagctgaaattataatagagtcccctttaaatgcacattctgtggatggctctcgccatttcctaagagatacattgtaaaatgtgacagtaatactgattctagcagaataaaacatgtaccacatttgctaatac
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]