ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2024-04-29 00:50:26, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_047438848 1991 bp mRNA linear PRI 05-OCT-2023
DEFINITION PREDICTED: Homo sapiens pregnancy specific beta-1-glycoprotein 8
(PSG8), transcript variant X2, mRNA.
ACCESSION XM_047438848
VERSION XM_047438848.1
DBLINK BioProject: PRJNA168
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NC_000019.10) annotated using gene prediction method: Gnomon,
supported by mRNA and EST evidence.
Also see:
Documentation of NCBI's Annotation Process
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI RefSeq
Annotation Status :: Updated annotation
Annotation Name :: GCF_000001405.40-RS_2023_10
Annotation Pipeline :: NCBI eukaryotic genome annotation
pipeline
Annotation Software Version :: 10.2
Annotation Method :: Best-placed RefSeq; Gnomon;
RefSeqFE; cmsearch; tRNAscan-SE
Features Annotated :: Gene; mRNA; CDS; ncRNA
Annotation Date :: 10/02/2023
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..1991
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="19"
gene 1..1991
/gene="PSG8"
/gene_synonym="PSG1"
/note="pregnancy specific beta-1-glycoprotein 8; Derived
by automated computational analysis using gene prediction
method: Gnomon. Supporting evidence includes similarity
to: 2 mRNAs, 8 ESTs, 8 long SRA reads, 4 Proteins, and 96%
coverage of the annotated genomic feature by RNAseq
alignments, including 3 samples with support for all
annotated introns"
/db_xref="GeneID:440533"
/db_xref="HGNC:HGNC:9525"
/db_xref="MIM:176397"
variation 1..5
/gene="PSG8"
/gene_synonym="PSG1"
/replace="ag"
/replace="agaag"
/db_xref="dbSNP:942835211"
variation 3
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1331975865"
variation 4
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1354406224"
variation 6
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1289672863"
variation 9
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:912734729"
variation 10
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:534233812"
variation 17
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1347785264"
variation 19
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1392922537"
variation 21
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:571949778"
variation 23
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1280134106"
variation 24
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1483488689"
variation 25
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1970201057"
variation 27
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1970201016"
variation 30
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2122295002"
variation 31
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1207649404"
variation 32
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1249698363"
variation 35
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:987012529"
variation 38
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:551635334"
variation 43
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1970200733"
variation 44
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1378084364"
variation 46
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1253904702"
variation 49
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1170561515"
variation 51
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:762517047"
variation 52
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:754197910"
variation 53
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1970200423"
variation 54
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1970200378"
variation 55
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1429980910"
variation 57
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1309402511"
variation 58
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:538084246"
variation 59
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:569073584"
variation 61
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:776107045"
variation 63
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:369010869"
variation 63
/gene="PSG8"
/gene_synonym="PSG1"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1292837925"
variation 64
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1250320053"
variation 65
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:759610460"
variation 67
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:774326303"
variation 68
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1600425982"
variation 69
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:771114706"
variation 70
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1439628924"
variation 71
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1369312871"
variation 72
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:749522143"
variation 74
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:375994401"
variation 75
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1343390676"
variation 76
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1396373254"
variation 78..84
/gene="PSG8"
/gene_synonym="PSG1"
/replace="acaca"
/replace="acacaca"
/db_xref="dbSNP:772403302"
variation 79
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1568381976"
variation 81
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1166627573"
variation 82..89
/gene="PSG8"
/gene_synonym="PSG1"
/replace="acag"
/replace="acagacag"
/db_xref="dbSNP:748571020"
variation 82
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:200337862"
variation 83
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1970199057"
variation 85
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:747988704"
variation 86
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:781138692"
variation 87
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:554451127"
variation 89
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:746461659"
variation 90
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1568381942"
variation 94
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:536412761"
variation 96
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1452807456"
variation 97
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:963052145"
variation 99
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:779444955"
variation 102
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1438136880"
variation 103
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1249770616"
variation 104
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:757986183"
variation 105
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:373909679"
variation 106
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:753133021"
variation 109
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1970197941"
variation 111
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1970197879"
variation 112
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1233195923"
variation 114..117
/gene="PSG8"
/gene_synonym="PSG1"
/replace="ccc"
/replace="cccc"
/db_xref="dbSNP:1970197640"
variation 114
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1970197757"
variation 115
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1342394703"
variation 117
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1461217760"
variation 120
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:146791116"
variation 121
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1240231787"
variation 122
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2122294398"
variation 123
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:759960457"
variation 126..132
/gene="PSG8"
/gene_synonym="PSG1"
/replace="cacagcg"
/replace="tgcagca"
/db_xref="dbSNP:71337226"
variation 126..127
/gene="PSG8"
/gene_synonym="PSG1"
/replace="ca"
/replace="tg"
/db_xref="dbSNP:34129574"
variation 126
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:7245423"
variation 127
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:62112127"
variation 128
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:763084223"
variation 129
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1970196999"
variation 130
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:773403623"
variation 131
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:200221981"
variation 132
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:7260508"
variation 133
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:768581313"
variation 134
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1307105432"
variation 136
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1470392320"
variation 137
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1422500289"
variation 138
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:142949326"
variation 139
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:757952650"
variation 142
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2122294173"
variation 144
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1010143443"
variation 145
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:61393109"
variation 147
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:756998284"
variation 149
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:145793435"
variation 151
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:369084125"
variation 153
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:755427646"
variation 154
/gene="PSG8"
/gene_synonym="PSG1"
/replace=""
/replace="g"
/db_xref="dbSNP:1647959059"
variation 154
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:752003225"
variation 159
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1970195709"
variation 160
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1970195660"
variation 161
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1259453451"
variation 162
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1480510918"
variation 163
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1970004400"
variation 166
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1277618052"
variation 168
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1177937470"
variation 169
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1427864985"
variation 170
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1970004155"
variation 171
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1469702081"
variation 172
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1970004057"
variation 173
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1171583773"
variation 175
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1970003946"
variation 177
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:371305028"
variation 178
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1568377474"
variation 179
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1322611052"
variation 180..189
/gene="PSG8"
/gene_synonym="PSG1"
/replace=""
/replace="ctctatcttt"
/db_xref="dbSNP:1970003501"
variation 180
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1970003714"
variation 181
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1217455729"
variation 185
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1970003617"
variation 187
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:148417392"
variation 191
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1970003443"
variation 193..194
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1970003320"
variation 193
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1288867598"
variation 195
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1346367116"
variation 196
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1406890101"
variation 197
/gene="PSG8"
/gene_synonym="PSG1"
/replace=""
/replace="a"
/db_xref="dbSNP:1281414721"
variation 198
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1970003074"
variation 199
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1408691320"
variation 201
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1336801295"
variation 203..206
/gene="PSG8"
/gene_synonym="PSG1"
/replace="tcaa"
/replace="tcaatcaa"
/db_xref="dbSNP:1021557431"
variation 204
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:968999073"
variation 207
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1970002778"
variation 208
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1439026090"
variation 210
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1309110407"
variation 211
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1202164435"
variation 212
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:563338278"
variation 216..218
/gene="PSG8"
/gene_synonym="PSG1"
/replace="t"
/replace="tat"
/db_xref="dbSNP:751336234"
variation 216
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1970002480"
variation 217
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:193255600"
variation 218
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1179375434"
variation 219
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1808522274"
variation 220
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:537307649"
variation 223
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1970002203"
variation 225
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1200996003"
variation 226
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1051499036"
variation 228
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1174366244"
variation 230
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1422263422"
variation 231
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1459107906"
variation 236
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1413381195"
variation 237
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1366466791"
variation 238
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1182020834"
variation 239
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:146228036"
variation 240
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1344890437"
variation 241
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:897594300"
variation 243
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1270760336"
variation 244
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:554386608"
variation 245..246
/gene="PSG8"
/gene_synonym="PSG1"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1970001341"
variation 247
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:187455904"
variation 248
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1970001238"
variation 250
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1296548830"
variation 251
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1970001135"
variation 253
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:910127690"
variation 254
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1224178010"
variation 255
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1600413284"
variation 258
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1288960561"
variation 259
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1450606133"
variation 260
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1215863136"
variation 262
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1568377389"
variation 264
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1970000752"
variation 265
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1244376584"
variation 266
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1182707639"
variation 268
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1970000585"
variation 269
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1186324146"
variation 273
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1393367439"
variation 275
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1600413245"
variation 276
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:182269674"
variation 279
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1970000279"
variation 280
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:552215014"
variation 281
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1257222247"
variation 283
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:948705744"
variation 284
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1320332805"
variation 287
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1600413212"
variation 289
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:10407391"
variation 290
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969999786"
variation 293
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1969999735"
variation 294
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:915940409"
variation 298
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969999606"
variation 299
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1969999547"
variation 300
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969999497"
variation 301..302
/gene="PSG8"
/gene_synonym="PSG1"
/replace=""
/replace="ct"
/db_xref="dbSNP:992800538"
variation 302..306
/gene="PSG8"
/gene_synonym="PSG1"
/replace="tgt"
/replace="tgtgt"
/db_xref="dbSNP:1301300310"
variation 302
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1383164003"
variation 304
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1370406997"
variation 308
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969999238"
variation 310
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969999191"
variation 311
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:960376842"
variation 312
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1223888061"
variation 313
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:924721354"
variation 314
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1445792402"
variation 319
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:138704720"
variation 320
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1401246365"
variation 322
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:551000017"
variation 323
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1182111515"
variation 324
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1969998654"
variation 327
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1470611429"
variation 328
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1408508812"
variation 329
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:968613001"
variation 330
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969998357"
variation 333
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1038963923"
variation 334
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1405808442"
variation 335
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:531277437"
variation 340
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969998091"
variation 343
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1007504019"
variation 345
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969997965"
variation 346
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1454418639"
variation 347
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969997850"
variation 350
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:865999283"
variation 354
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:562366136"
variation 355
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1465957525"
variation 356
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1280795088"
variation 357
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1348007095"
variation 358
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1392763830"
variation 359
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:112514072"
variation 360
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1202203898"
variation 361
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1439943997"
variation 362
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1969997336"
variation 364
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1029980966"
variation 365
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1237125687"
variation 367
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1438621981"
variation 369
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:997196579"
variation 370
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1231388960"
variation 371
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:897537575"
variation 379
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969996998"
variation 382
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1177212022"
variation 385
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1036149069"
variation 386
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1279043816"
variation 387
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1174014860"
variation 388
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1410318990"
variation 389
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:528681741"
variation 393
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1048613160"
variation 394
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:948943677"
variation 395
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1347960832"
variation 396
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1222157014"
CDS 397..1317
/gene="PSG8"
/gene_synonym="PSG1"
/codon_start=1
/product="pregnancy-specific beta-1-glycoprotein 8 isoform
X2"
/protein_id="XP_047294804.1"
/db_xref="GeneID:440533"
/db_xref="HGNC:HGNC:9525"
/db_xref="MIM:176397"
/translation="
MSLAREAAEKTYLGRQSKTETKKIPALHAPMETPKPSISSSKLNPREAMEAVSLTCDPETPDASYLWWMNGQSLPMSHRLQLSETNRTLFLLGVTKYTAGPYECEIRNPVSASRSDPFTLNLLPKLPKPYITINNLKPRENKDVLNFTCEPKSENYTYIWWLNGQSLPVSPRVKRPIENRILILPSVTRNETGPYQCEIRDQYGGIRSYPVTLNVLYGPDLPRIYPSFTYYRSGEVLYLSCSADSNPPAQYSWTINGKFQLSGQKLFIPQITTKHSGLYACSVRNSATGKESSKSMTVKVSDWTLP"
misc_feature 499..765
/gene="PSG8"
/gene_synonym="PSG1"
/note="Immunoglobulin (Ig)-like domain of human
carcinoembryonic antigen (CEA) related cell adhesion
molecule (CEACAM) domains 2, 4, and 6, and similar
domains; Region: IgI_hCEACAM_2_4_6_like; cd05740"
/db_xref="CDD:409402"
misc_feature 499..513
/gene="PSG8"
/gene_synonym="PSG1"
/note="Ig strand A [structural motif]; Region: Ig strand
A"
/db_xref="CDD:409402"
misc_feature 520..537
/gene="PSG8"
/gene_synonym="PSG1"
/note="Ig strand A' [structural motif]; Region: Ig strand
A'"
/db_xref="CDD:409402"
misc_feature 550..570
/gene="PSG8"
/gene_synonym="PSG1"
/note="Ig strand B [structural motif]; Region: Ig strand
B"
/db_xref="CDD:409402"
misc_feature 589..606
/gene="PSG8"
/gene_synonym="PSG1"
/note="Ig strand C [structural motif]; Region: Ig strand
C"
/db_xref="CDD:409402"
misc_feature 610..621
/gene="PSG8"
/gene_synonym="PSG1"
/note="Ig strand C' [structural motif]; Region: Ig strand
C'"
/db_xref="CDD:409402"
misc_feature 631..645
/gene="PSG8"
/gene_synonym="PSG1"
/note="Ig strand D [structural motif]; Region: Ig strand
D"
/db_xref="CDD:409402"
misc_feature 652..669
/gene="PSG8"
/gene_synonym="PSG1"
/note="Ig strand E [structural motif]; Region: Ig strand
E"
/db_xref="CDD:409402"
misc_feature 697..723
/gene="PSG8"
/gene_synonym="PSG1"
/note="Ig strand F [structural motif]; Region: Ig strand
F"
/db_xref="CDD:409402"
misc_feature 733..762
/gene="PSG8"
/gene_synonym="PSG1"
/note="Ig strand G [structural motif]; Region: Ig strand
G"
/db_xref="CDD:409402"
misc_feature 778..1044
/gene="PSG8"
/gene_synonym="PSG1"
/note="Immunoglobulin domain; Region: Ig; cl11960"
/db_xref="CDD:448366"
misc_feature 829..843
/gene="PSG8"
/gene_synonym="PSG1"
/note="Ig strand B [structural motif]; Region: Ig strand
B"
/db_xref="CDD:409353"
misc_feature 868..882
/gene="PSG8"
/gene_synonym="PSG1"
/note="Ig strand C [structural motif]; Region: Ig strand
C"
/db_xref="CDD:409353"
misc_feature 934..948
/gene="PSG8"
/gene_synonym="PSG1"
/note="Ig strand E [structural motif]; Region: Ig strand
E"
/db_xref="CDD:409353"
misc_feature 976..993
/gene="PSG8"
/gene_synonym="PSG1"
/note="Ig strand F [structural motif]; Region: Ig strand
F"
/db_xref="CDD:409353"
misc_feature 1021..1032
/gene="PSG8"
/gene_synonym="PSG1"
/note="Ig strand G [structural motif]; Region: Ig strand
G"
/db_xref="CDD:409353"
misc_feature 1069..1296
/gene="PSG8"
/gene_synonym="PSG1"
/note="Fifth immunoglobulin (Ig)-like domain of the
carcinoembryonic antigen (CEA) related cell adhesion
molecule 5 (CEACAM5) and similar domains; member of the
C2-set IgSF domains; Region: IgC2_CEACAM5-like; cd20948"
/db_xref="CDD:409540"
misc_feature 1069..1089
/gene="PSG8"
/gene_synonym="PSG1"
/note="Ig strand A [structural motif]; Region: Ig strand
A"
/db_xref="CDD:409540"
misc_feature 1102..1125
/gene="PSG8"
/gene_synonym="PSG1"
/note="Ig strand B [structural motif]; Region: Ig strand
B"
/db_xref="CDD:409540"
misc_feature 1141..1161
/gene="PSG8"
/gene_synonym="PSG1"
/note="Ig strand C [structural motif]; Region: Ig strand
C"
/db_xref="CDD:409540"
misc_feature 1168..1185
/gene="PSG8"
/gene_synonym="PSG1"
/note="Ig strand C' [structural motif]; Region: Ig strand
C'"
/db_xref="CDD:409540"
misc_feature 1192..1212
/gene="PSG8"
/gene_synonym="PSG1"
/note="Ig strand E [structural motif]; Region: Ig strand
E"
/db_xref="CDD:409540"
misc_feature 1219..1254
/gene="PSG8"
/gene_synonym="PSG1"
/note="Ig strand F [structural motif]; Region: Ig strand
F"
/db_xref="CDD:409540"
misc_feature 1261..1296
/gene="PSG8"
/gene_synonym="PSG1"
/note="Ig strand G [structural motif]; Region: Ig strand
G"
/db_xref="CDD:409540"
variation 399
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1345598900"
variation 401
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969996249"
variation 403
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:916182445"
variation 405
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969996134"
variation 406
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969996065"
variation 407
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1340581178"
variation 409
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1278318563"
variation 415
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1197907701"
variation 416
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1242337568"
variation 418
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1969995721"
variation 419
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:2122252920"
variation 420
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:2122252894"
variation 428
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1600412926"
variation 432
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1482832781"
variation 434
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1200262547"
variation 435
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:146023590"
variation 436
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1481381909"
variation 438
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:546252726"
variation 439
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:577174040"
variation 440
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:938701375"
variation 442
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1342683782"
variation 446
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1428649956"
variation 448
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969995074"
variation 451
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:924679227"
variation 455
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1969994968"
variation 456
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:759497410"
variation 458
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:977571332"
variation 461
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1366820640"
variation 464
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:200326098"
variation 465
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1402542842"
variation 467
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1969994766"
variation 469
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:947183486"
variation 476
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969994646"
variation 477
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:914381404"
variation 478
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1268740479"
variation 481
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1341742482"
variation 484
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:2122252571"
variation 488
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:779332335"
variation 489
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:771018602"
variation 491
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:558757365"
variation 492
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:778098439"
variation 498
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969983813"
variation 500
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969983757"
variation 501
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:538452549"
variation 502..507
/gene="PSG8"
/gene_synonym="PSG1"
/replace="cc"
/replace="ccctcc"
/db_xref="dbSNP:1433291072"
variation 502
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:142534823"
variation 503
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:140447066"
variation 506
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:536270387"
variation 509
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:766251497"
variation 510
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:149695044"
variation 511
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1969982999"
variation 512
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:867607684"
variation 516
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:749942568"
variation 517
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1366781239"
variation 520..522
/gene="PSG8"
/gene_synonym="PSG1"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:1423323095"
variation 522
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:764813765"
variation 526
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:375466268"
variation 528
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:140758943"
variation 530
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1187722601"
variation 531
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1383101071"
variation 532
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1449691728"
variation 533
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1426474877"
variation 534
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969982055"
variation 535
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:150936706"
variation 536
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1355111172"
variation 537
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969981875"
variation 538
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:771369931"
variation 539..540
/gene="PSG8"
/gene_synonym="PSG1"
/replace="cc"
/replace="ccc"
/db_xref="dbSNP:763998736"
variation 539
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:371839942"
variation 541
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1568376851"
variation 542
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:778012119"
variation 543
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:770054634"
variation 544
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:535298341"
variation 546
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:781603858"
variation 547
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:754754255"
variation 549
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1333133667"
variation 551
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1969981028"
variation 552
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969980934"
variation 554
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:751341959"
variation 555
/gene="PSG8"
/gene_synonym="PSG1"
/replace=""
/replace="c"
/db_xref="dbSNP:1309994977"
variation 555
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:758282363"
variation 558
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:750421440"
variation 559
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:116389883"
variation 560
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:142497726"
variation 561
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1969980396"
variation 567
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:139444715"
variation 568
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:759901877"
variation 569
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1969980140"
variation 571
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:146269254"
variation 573
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1406457514"
variation 575
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:967623353"
variation 577
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:771409114"
variation 578
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1331848688"
variation 579
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:187064013"
variation 580
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:773921328"
variation 582
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:143424985"
variation 583
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:532578985"
variation 587
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1483061049"
variation 588
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1273487928"
variation 590
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1600411740"
variation 592
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:183657521"
variation 593
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1347655808"
variation 594
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:779703066"
variation 595
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:758282702"
variation 596
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969978816"
variation 597
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1969978750"
variation 598
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1278233047"
variation 599..600
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1290712247"
variation 599
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:549833586"
variation 600
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:778873646"
variation 603
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:756703739"
variation 604
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1249635757"
variation 608
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:753374011"
variation 609
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:763733366"
variation 610
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969978137"
variation 615
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:139925716"
variation 617
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:752451004"
variation 619
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1478910703"
variation 620
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:766646869"
variation 622
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:763450783"
variation 623
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1401083208"
variation 624
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:773833315"
variation 625
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:145990413"
variation 626
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:761918495"
variation 630
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1368241270"
variation 631
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:776589569"
variation 633
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:768840904"
variation 634
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:267605519"
variation 635
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:775825555"
variation 636
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1600411547"
variation 637
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:370640395"
variation 638
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:745689620"
variation 639
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1321769610"
variation 640
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:79897706"
variation 641
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1229533476"
variation 642
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:138201287"
variation 643
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:757187521"
variation 644
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:748734736"
variation 645
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:777131876"
variation 646
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:755714443"
variation 650
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:752258674"
variation 651
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:146641163"
variation 653
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1451670664"
variation 654
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:767372250"
variation 656
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1263037383"
variation 657
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1322551149"
variation 658
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1457671748"
variation 659
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1410645787"
variation 660
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:777263751"
variation 661
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:764052314"
variation 663
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:760861543"
variation 664
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969975327"
variation 666
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1170157549"
variation 667
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:373585002"
variation 668
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2122248446"
variation 669
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:772315876"
variation 670
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:192338151"
variation 671
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969975054"
variation 672
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:116299426"
variation 673
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:770768411"
variation 674
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1209957795"
variation 677
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:545223763"
variation 680
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:777804512"
variation 683
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969974690"
variation 684
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:377706171"
variation 685
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1357078899"
variation 687
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:779209108"
variation 688
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2122248237"
variation 689
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:2122248223"
variation 691
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:751315814"
variation 693
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969974252"
variation 694
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1380354144"
variation 695
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1322269908"
variation 697
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1327456298"
variation 698
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1217784155"
variation 701
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1435477209"
variation 702
/gene="PSG8"
/gene_synonym="PSG1"
/replace=""
/replace="t"
/db_xref="dbSNP:1969973769"
variation 703
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1344564544"
variation 704
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1295729514"
variation 714
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:374584397"
variation 715
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:141410321"
variation 716
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:139399276"
variation 720
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:146905361"
variation 721
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:144055035"
variation 723
/gene="PSG8"
/gene_synonym="PSG1"
/replace=""
/replace="a"
/db_xref="dbSNP:372980211"
variation 723
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1600411157"
variation 724
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:371313519"
variation 725
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:759738109"
variation 728
/gene="PSG8"
/gene_synonym="PSG1"
/replace=""
/replace="g"
/db_xref="dbSNP:1969972803"
variation 728
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:967991530"
variation 729
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:770680437"
variation 730
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1189646092"
variation 731
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1449174237"
variation 735
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:772973031"
variation 736
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:138487637"
variation 737
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:747553898"
variation 738
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1289206727"
variation 740
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1969972020"
variation 741
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1220596852"
variation 742
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1455930199"
variation 744..746
/gene="PSG8"
/gene_synonym="PSG1"
/replace="cc"
/replace="ccc"
/db_xref="dbSNP:1360940727"
variation 744
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1344607151"
variation 745
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:780837177"
variation 746
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:768349850"
variation 748
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:143748376"
variation 750
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:779904614"
variation 752
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1256135479"
variation 753
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:754264222"
variation 755
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1302014848"
variation 758
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:553846287"
variation 759
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1969971024"
variation 760
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969970954"
variation 763
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:2122247544"
variation 764
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:756654089"
variation 766
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:753198802"
variation 767
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:780177782"
variation 768
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:758446289"
variation 772
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:985811256"
variation 775..777
/gene="PSG8"
/gene_synonym="PSG1"
/replace="cc"
/replace="ccc"
/db_xref="dbSNP:1314551055"
variation 775
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:750634211"
variation 776
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969894689"
variation 779
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:765397920"
variation 780
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:953187297"
variation 781
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1199823950"
variation 783
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969894276"
variation 784
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1228529789"
variation 785
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:757075624"
variation 786
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:753687202"
variation 787
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:923011961"
variation 789
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2122236955"
variation 790..798
/gene="PSG8"
/gene_synonym="PSG1"
/replace="ac"
/replace="accatcaac"
/db_xref="dbSNP:764623194"
variation 790
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1645031075"
variation 791
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:370276579"
variation 792
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:752752664"
variation 793
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:767025509"
variation 795..801
/gene="PSG8"
/gene_synonym="PSG1"
/replace="caacaac"
/replace="caacaacaac"
/db_xref="dbSNP:1207829854"
variation 795
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1451794178"
variation 797
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:528667542"
variation 798
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:774007363"
variation 799
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1380077196"
variation 800
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:78350496"
variation 801
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:769075478"
variation 802
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1286604547"
variation 803
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:780473816"
variation 804
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1451021979"
variation 806
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:772140769"
variation 807
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:532388978"
variation 809
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969892271"
variation 810
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1484645075"
variation 811
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969892120"
variation 812
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1183213783"
variation 813
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1266662840"
variation 814
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1222833818"
variation 816
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:144938138"
variation 818
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1969891738"
variation 819
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1600406795"
variation 820
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1159808386"
variation 821
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1358312519"
variation 822
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1224552667"
variation 823
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:779121780"
variation 824
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:757563975"
variation 826
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1366363816"
variation 830
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969891056"
variation 832
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:754167064"
variation 833
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:777710774"
variation 834
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:756016570"
variation 835
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:894494535"
variation 837
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:752661524"
variation 838
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:370986372"
variation 839
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:759047700"
variation 840
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1969890450"
variation 842
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1431457796"
variation 843
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969890305"
variation 844
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:2122236515"
variation 847
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1373423846"
variation 848
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:751037122"
variation 851
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:765998483"
variation 854
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969889966"
variation 856
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:140231543"
variation 864
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:772891067"
variation 865
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:761048202"
variation 866
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:745899134"
variation 869
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969889462"
variation 870
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:543391467"
variation 871
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:146653609"
variation 872
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:749493177"
variation 873
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1225643089"
variation 875..876
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="gg"
/db_xref="dbSNP:759137475"
variation 875
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:778192434"
variation 876
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1969888842"
variation 879
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1426365387"
variation 880
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:755926501"
variation 881
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:752468754"
variation 884
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:781118462"
variation 886
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:375688393"
variation 887
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:751572740"
variation 888
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1466330389"
variation 891
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:765843579"
variation 892
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1374731182"
variation 893
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:374595113"
variation 894
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:374769387"
variation 896
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:560841302"
variation 897
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:761032137"
variation 899
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:775728209"
variation 900
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:541230835"
variation 906
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:940413217"
variation 907
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1365177236"
variation 909
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:774966862"
variation 910
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969887217"
variation 911
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:771117205"
variation 912
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1484406485"
variation 913
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:749405027"
variation 915..917
/gene="PSG8"
/gene_synonym="PSG1"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1322474829"
variation 915
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969886992"
variation 918
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:907666049"
variation 919
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:773530892"
variation 920
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:113087470"
variation 921
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:747919964"
variation 922
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:780835798"
variation 923
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:746897583"
variation 926
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:200400261"
variation 928
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:953014149"
variation 929
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2122236035"
variation 933
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:202164066"
variation 934
/gene="PSG8"
/gene_synonym="PSG1"
/replace=""
/replace="a"
/db_xref="dbSNP:1285296408"
variation 935
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:572099259"
variation 936
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:867195556"
variation 938
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:757862245"
variation 939
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:749936665"
variation 942
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1427058111"
variation 946
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1969885823"
variation 950
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1409400000"
variation 953
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:764809746"
variation 959
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:558641447"
variation 960
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:544743837"
variation 963
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1969885426"
variation 966
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:767745515"
variation 971
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:2122235917"
variation 972
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1438518130"
variation 973
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969885282"
variation 974
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:759998253"
variation 976
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1244091627"
variation 977
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1203639027"
variation 978
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1460387761"
variation 981
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:774953276"
variation 982
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1205794631"
variation 984
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1350030021"
variation 986
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969884730"
variation 987
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:142609328"
variation 990
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1568374431"
variation 991
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:763060753"
variation 994
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:372083751"
variation 995
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1315501297"
variation 996
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1194683193"
variation 997
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1451596557"
variation 998
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:769974448"
variation 999
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:776959430"
variation 1000
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:768287272"
variation 1001
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:11879884"
variation 1005
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:745861236"
variation 1007
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:143061243"
variation 1010
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:756828271"
variation 1011
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:753413480"
variation 1012
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1443090258"
variation 1013
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1600406198"
variation 1015
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:200167716"
variation 1016
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:140722778"
variation 1018
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1446541669"
variation 1019
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1301184661"
variation 1020..1021
/gene="PSG8"
/gene_synonym="PSG1"
/replace="t"
/replace="tt"
/db_xref="dbSNP:776136827"
variation 1020
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:751980064"
variation 1021
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:111674083"
variation 1022
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969882349"
variation 1023
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1291232906"
variation 1025
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:940398489"
variation 1027
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1244996770"
variation 1028
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1568374324"
variation 1029
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:765207960"
variation 1031
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:376880595"
variation 1032
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:2122235467"
variation 1033
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:776675549"
variation 1035
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:768926626"
variation 1038
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1969881608"
variation 1042
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:760402112"
variation 1043
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1425962268"
variation 1046
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969867799"
variation 1047
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1224989568"
variation 1048
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:536269041"
variation 1049
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:770908424"
variation 1050
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:748692125"
variation 1051
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969867386"
variation 1052
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1741041617"
variation 1054
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:772767775"
variation 1055
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969867220"
variation 1056
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:377240511"
variation 1057
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:138526624"
variation 1059
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1375082156"
variation 1061
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1969866812"
variation 1065
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1018693425"
variation 1071
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:758796006"
variation 1073
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1969866584"
variation 1075
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969866506"
variation 1076
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1969866439"
variation 1077
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1353121755"
variation 1080
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1339309377"
variation 1082
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:150464724"
variation 1083
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:779228247"
variation 1085
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:141515836"
variation 1090..1091
/gene="PSG8"
/gene_synonym="PSG1"
/replace=""
/replace="cg"
/db_xref="dbSNP:1169798347"
variation 1090
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:757765664"
variation 1091
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:148019273"
variation 1092
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:764199390"
variation 1093
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1469497887"
variation 1095..1099
/gene="PSG8"
/gene_synonym="PSG1"
/replace="ag"
/replace="aggag"
/db_xref="dbSNP:749723624"
variation 1096
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1230942496"
variation 1097
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:756231515"
variation 1098
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969865295"
variation 1101
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:752870751"
variation 1102
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1064489"
variation 1103
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1064490"
variation 1104
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1307351344"
variation 1105
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1406472449"
variation 1108
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1300919358"
variation 1111
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:774211789"
variation 1113
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:766147229"
variation 1115
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:762945492"
variation 1116
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969864311"
variation 1117
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:551641047"
variation 1118
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1568373675"
variation 1119
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1317634029"
variation 1121
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1453780078"
variation 1124
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:769407964"
variation 1125
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:747690807"
variation 1126
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:373734899"
variation 1128
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:116480924"
variation 1130
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1969863554"
variation 1131
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969863481"
variation 1133
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1158716488"
variation 1135
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969863332"
variation 1136
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1600405021"
variation 1137
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969863183"
variation 1138
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:779329080"
variation 1139
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:757599628"
variation 1140
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1058758"
variation 1141
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1444950954"
variation 1144
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1058763"
variation 1145
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:146672854"
variation 1146
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:752782848"
variation 1147
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:892021477"
variation 1150
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:368908706"
variation 1151
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969862270"
variation 1152
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1969862190"
variation 1153
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1054746002"
variation 1155
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:755183019"
variation 1157
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1568373575"
variation 1159
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969861837"
variation 1161
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1969861771"
variation 1162
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:751797895"
variation 1163
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:542714417"
variation 1165
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1247193012"
variation 1166
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:766168104"
variation 1167
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:762706287"
variation 1169
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:773159611"
variation 1170
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:765268200"
variation 1171
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1288395818"
variation 1176
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:761349940"
variation 1178
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1367696932"
variation 1179
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:776266928"
variation 1180
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:114673766"
variation 1181
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1384341498"
variation 1184
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:141151331"
variation 1185
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:775051339"
variation 1187
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:974719797"
variation 1189
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969860286"
variation 1191
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:775456119"
variation 1192
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969860210"
variation 1193
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:771274488"
variation 1194
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:749649602"
variation 1197
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969859946"
variation 1200..1204
/gene="PSG8"
/gene_synonym="PSG1"
/replace="cccc"
/replace="ccccc"
/db_xref="dbSNP:780656185"
variation 1201
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969859887"
variation 1202
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:778188699"
variation 1204
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:770302624"
variation 1205
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1568373467"
variation 1206
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:116682333"
variation 1207
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:751785407"
variation 1209
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:376501776"
variation 1212
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:758143768"
variation 1213
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:750196314"
variation 1218
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:950604642"
variation 1219
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1184351465"
variation 1220
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:765182014"
variation 1221
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:761836748"
variation 1222
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1568373417"
variation 1223
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1404539598"
variation 1224
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:753863481"
variation 1225
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:149943830"
variation 1227
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:566992814"
variation 1228
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:775165084"
variation 1229..1237
/gene="PSG8"
/gene_synonym="PSG1"
/replace="tctatgctt"
/replace="tctatgcttctatgctt"
/db_xref="dbSNP:1336866372"
variation 1230
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:771631368"
variation 1232
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:373062276"
variation 1233..1240
/gene="PSG8"
/gene_synonym="PSG1"
/replace="tgct"
/replace="tgcttgct"
/db_xref="dbSNP:769747759"
variation 1233
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1430752317"
variation 1234
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969857933"
variation 1235
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1382246325"
variation 1238
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:370144520"
variation 1239
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1407633030"
variation 1242
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:139148701"
variation 1246
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:375725440"
variation 1247
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:151185117"
variation 1250
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1251306336"
variation 1251
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1350315441"
variation 1252
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1217301565"
variation 1255
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:747091663"
variation 1256
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1338160468"
variation 1257
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1204512737"
variation 1261..1262
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="gg"
/db_xref="dbSNP:746023465"
variation 1261
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1284031249"
variation 1262
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1222942685"
variation 1263
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1255301940"
variation 1265
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:372480345"
variation 1267
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1969856252"
variation 1269
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1969856164"
variation 1271
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:200488282"
variation 1274
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:891936994"
variation 1275
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1969855937"
variation 1278
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1600404468"
variation 1279
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969855788"
variation 1282
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1969855706"
variation 1283
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1568373317"
variation 1284
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:144735943"
variation 1285
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:757163453"
variation 1286
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:753777211"
variation 1288
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1969855243"
variation 1289
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1969855163"
variation 1290..1293
/gene="PSG8"
/gene_synonym="PSG1"
/replace="aa"
/replace="aaaa"
/db_xref="dbSNP:1302792592"
variation 1290
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:140787148"
variation 1291
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:752164628"
variation 1294
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1568373281"
variation 1295
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1176524770"
variation 1300
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1479790039"
variation 1303
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:751557759"
variation 1305
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:756918298"
variation 1306
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:776998124"
variation 1307
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:753503327"
variation 1308
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:781668606"
variation 1309
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:755445760"
variation 1311
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:752067949"
variation 1312
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:188113038"
variation 1313
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:758343639"
variation 1314
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1301202083"
variation 1315
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:2122228307"
variation 1321
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:542861264"
variation 1322
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:750531585"
variation 1325
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:765293518"
variation 1326
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1277169996"
variation 1327
/gene="PSG8"
/gene_synonym="PSG1"
/replace=""
/replace="g"
/db_xref="dbSNP:553477524"
variation 1327
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:762062469"
variation 1328
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:776886149"
variation 1329
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:763826204"
variation 1330
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1378225386"
variation 1331
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:760490169"
variation 1332
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969828374"
variation 1333
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:199501013"
variation 1334
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:201922032"
variation 1335
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:745847726"
variation 1337
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1486552060"
variation 1339
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:773910144"
variation 1340
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:770390890"
variation 1348
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:748952588"
variation 1349
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1294435517"
variation 1350
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:755355428"
variation 1351
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1321648388"
variation 1352
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1969827672"
variation 1353
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:747384316"
variation 1354
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:780651182"
variation 1355
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1969827528"
variation 1356
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1362711658"
variation 1358
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969827425"
variation 1359
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:758932998"
variation 1361
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:149721508"
variation 1364
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:757305607"
variation 1365..1369
/gene="PSG8"
/gene_synonym="PSG1"
/replace="aaaa"
/replace="aaaaa"
/db_xref="dbSNP:1158002541"
variation 1366
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:184518374"
variation 1367
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1296199120"
variation 1368
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969826957"
variation 1369..1372
/gene="PSG8"
/gene_synonym="PSG1"
/replace=""
/replace="agac"
/db_xref="dbSNP:1969826778"
variation 1370
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1969826872"
variation 1371
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1006720785"
variation 1372
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1468652536"
variation 1374
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1367570772"
variation 1375..1376
/gene="PSG8"
/gene_synonym="PSG1"
/replace=""
/replace="tt"
/db_xref="dbSNP:1969826641"
variation 1375
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1969826693"
variation 1376
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:192494501"
variation 1378
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1300290278"
variation 1379
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1969826419"
variation 1379
/gene="PSG8"
/gene_synonym="PSG1"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1204704574"
variation 1380
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1340426425"
variation 1381..1382
/gene="PSG8"
/gene_synonym="PSG1"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1969826281"
variation 1381
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1568372571"
variation 1388
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1290787234"
variation 1389
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969826194"
variation 1390
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:80050376"
variation 1392
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1444427944"
variation 1394
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1029278748"
variation 1395
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969825979"
variation 1397
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1969825926"
variation 1400
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1969825878"
variation 1401
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1241632548"
variation 1402
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:371523500"
variation 1404
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1189090951"
variation 1405
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1391789334"
variation 1416
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1465690545"
variation 1418
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1447378647"
variation 1425
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1167098376"
variation 1426
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1414158788"
variation 1428
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1038153030"
variation 1429
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1321063428"
variation 1430
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969825417"
variation 1431
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969825378"
variation 1432
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:941122028"
variation 1433
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1436499534"
variation 1434
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:887922480"
variation 1437
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1284467258"
variation 1438
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:558233510"
variation 1442
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:879586492"
variation 1444
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969825041"
variation 1445
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969824989"
variation 1446
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1285149273"
variation 1447
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969824892"
variation 1450
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1045260648"
variation 1451
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969824777"
variation 1452
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:8100679"
variation 1453
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:948251195"
variation 1455
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1249889144"
variation 1460
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1435736728"
variation 1461
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1192258621"
variation 1462
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1344608147"
variation 1467
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:569186357"
variation 1471
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1316103491"
variation 1472
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:918211943"
variation 1473
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:796273310"
variation 1474
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:935373418"
variation 1475
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1969824144"
variation 1476
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:796618267"
variation 1478
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1969824032"
variation 1479
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:555655343"
variation 1482
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:968105500"
variation 1483
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1018027052"
variation 1486
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:188167768"
variation 1487
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1230386357"
variation 1489
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1266285076"
variation 1494
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1327060451"
variation 1497
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:566626116"
variation 1498
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:546462782"
variation 1499
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1450467991"
variation 1501
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1600402320"
variation 1505
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:2122227578"
variation 1506
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1600402316"
variation 1508
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969823443"
variation 1510
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1184975541"
variation 1512
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:994227157"
variation 1513
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1472710608"
variation 1516
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969823289"
variation 1517
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:533076275"
variation 1518..1521
/gene="PSG8"
/gene_synonym="PSG1"
/replace="ggac"
/replace="ggacggac"
/db_xref="dbSNP:1173604984"
variation 1518
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1409099247"
variation 1520..1526
/gene="PSG8"
/gene_synonym="PSG1"
/replace="acaa"
/replace="acaacaa"
/db_xref="dbSNP:1351381337"
variation 1520
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1453716748"
variation 1522..1523
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1404818991"
variation 1523
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1969822986"
variation 1524
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:570208587"
variation 1527
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1411878937"
variation 1528
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969822843"
variation 1529
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:550200968"
variation 1530
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969822737"
variation 1531
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1289916532"
variation 1537
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1221302857"
variation 1541
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1238242783"
variation 1542
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1356744747"
variation 1543..1546
/gene="PSG8"
/gene_synonym="PSG1"
/replace="tg"
/replace="tgtg"
/db_xref="dbSNP:1256453585"
variation 1545
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969822507"
variation 1547
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1347015857"
variation 1548
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969822356"
variation 1549
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1198583991"
variation 1552
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969822262"
variation 1554
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969822204"
variation 1557
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1279300047"
variation 1558
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:905619354"
variation 1559..1574
/gene="PSG8"
/gene_synonym="PSG1"
/replace="caagatgtcagaacaa"
/replace="caagatgtcagaacaacaagatgtcagaacaa"
/db_xref="dbSNP:1969821827"
variation 1559
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1969822058"
variation 1562
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1045255453"
variation 1563
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1248991362"
variation 1569
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:530383727"
variation 1572
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1268370812"
variation 1576
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1198938186"
variation 1582
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969821755"
variation 1586
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:896725669"
variation 1589
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1477309860"
variation 1590
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1056689430"
variation 1591
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969821593"
variation 1594
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1438457639"
variation 1595
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1431892439"
variation 1596
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1969821439"
variation 1597
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1969821388"
variation 1600
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:562845772"
variation 1601
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1387481876"
variation 1603
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1969821231"
variation 1604
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:923923457"
variation 1609
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1303766985"
variation 1610
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1600402164"
variation 1611
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1969821043"
variation 1612
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1231964298"
variation 1613
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1404405468"
variation 1614
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969820841"
variation 1615
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:979847108"
variation 1616
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1230178998"
variation 1619
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1364006483"
variation 1623
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1731096412"
variation 1625
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1969820666"
variation 1627
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:946792845"
variation 1628
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:911347525"
variation 1632
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1209958269"
variation 1633
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:985244342"
variation 1636
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969820481"
variation 1637
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1450420741"
variation 1641
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969820405"
variation 1642
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1969820352"
variation 1643
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1969820299"
variation 1644
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1193521092"
variation 1646
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1430847062"
variation 1647
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1419205192"
variation 1649
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1166685804"
variation 1652
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1969820032"
variation 1658
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1969819990"
variation 1663
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1372788606"
variation 1665
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969819892"
variation 1667
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969819850"
variation 1671
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1600402105"
variation 1673
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1458574692"
variation 1676
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1568372304"
variation 1678
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969819683"
variation 1680
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1295410436"
variation 1681
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1969819592"
variation 1686
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:543274895"
variation 1689
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:955237718"
variation 1690
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1969819473"
variation 1694
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1969819423"
variation 1697
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:529478127"
variation 1701
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969819301"
variation 1702
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1306612286"
variation 1707
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1245010414"
variation 1711
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969819144"
variation 1712
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1969819097"
variation 1714
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1969819064"
variation 1715
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1600402064"
variation 1717
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1353560186"
variation 1724
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:961593083"
variation 1728
/gene="PSG8"
/gene_synonym="PSG1"
/replace=""
/replace="c"
/db_xref="dbSNP:1969818848"
variation 1728
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:184905131"
variation 1729..1732
/gene="PSG8"
/gene_synonym="PSG1"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1205374831"
variation 1733..1734
/gene="PSG8"
/gene_synonym="PSG1"
/replace=""
/replace="tct"
/replace="tctcaaccatctcaacc"
/db_xref="dbSNP:377417293"
variation 1734
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:867121094"
variation 1735
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:868329145"
variation 1736
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1167129429"
variation 1739
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969818417"
variation 1740
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1366812876"
variation 1741
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1969818311"
variation 1745..1746
/gene="PSG8"
/gene_synonym="PSG1"
/replace=""
/replace="ag"
/db_xref="dbSNP:1969818210"
variation 1745
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1969818262"
variation 1747
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1005257632"
variation 1748
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1159998621"
variation 1749
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:540446529"
variation 1752
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:145343959"
variation 1753
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:2122226802"
variation 1757
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1360969402"
variation 1761
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:372046484"
variation 1762
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1314356262"
variation 1763
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1353160992"
variation 1766
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969817827"
variation 1768
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1232219504"
variation 1772
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969817746"
variation 1773
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1331901919"
variation 1775
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1022748969"
variation 1776
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:544622272"
variation 1777
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1014026600"
variation 1779
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1183950168"
variation 1780
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1254416918"
variation 1781
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:139905455"
variation 1782
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1969817261"
variation 1783
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:150844587"
variation 1785
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969817152"
variation 1786
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:999746466"
variation 1788
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1354333291"
variation 1789
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:902796468"
variation 1790
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1344396987"
variation 1791
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1043728764"
variation 1793
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1373278974"
variation 1794
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969816754"
variation 1796
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969816707"
variation 1801
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969816652"
variation 1807
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1413764016"
variation 1808
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1969816549"
variation 1809
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1288451813"
variation 1811
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:574059218"
variation 1812
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1430689975"
variation 1814
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:7246152"
variation 1815
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1969816294"
variation 1817
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1212734281"
variation 1819
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969816204"
variation 1821
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:934097326"
variation 1823
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1485481917"
variation 1828
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:113347815"
variation 1832
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:193036086"
variation 1833
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1468618435"
variation 1834
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1969815925"
variation 1836
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969815882"
variation 1837
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:553179997"
variation 1838
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1176672703"
variation 1840
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1182462710"
variation 1841
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:187443059"
variation 1842
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1969815610"
variation 1843
/gene="PSG8"
/gene_synonym="PSG1"
/replace=""
/replace="g"
/db_xref="dbSNP:1178023326"
variation 1846
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969815515"
variation 1848
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:879801642"
variation 1850
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969815409"
variation 1853
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1433747148"
variation 1856
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1969815309"
variation 1857
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969815265"
variation 1859
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:114518895"
variation 1860
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969815164"
variation 1861
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969815127"
variation 1864
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1568372126"
variation 1866
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1442765588"
variation 1867
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1262477481"
variation 1869..1871
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="ata"
/db_xref="dbSNP:1347529930"
variation 1869
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:969683847"
variation 1870
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:372060994"
variation 1871
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969814734"
variation 1872
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1229435317"
variation 1874
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1013972689"
variation 1875..1876
/gene="PSG8"
/gene_synonym="PSG1"
/replace=""
/replace="tc"
/db_xref="dbSNP:1203960262"
variation 1876
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1969814524"
variation 1877
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:960063849"
variation 1879
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1231841504"
variation 1885
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969814446"
variation 1887
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1393041090"
variation 1888
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1453510390"
variation 1890
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969814358"
variation 1893
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1224551040"
variation 1894
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1035186270"
variation 1895..1898
/gene="PSG8"
/gene_synonym="PSG1"
/replace="tgtg"
/replace="tgtgtg"
/db_xref="dbSNP:1349917176"
variation 1895
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1407836867"
variation 1898..1899
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1969814127"
variation 1899
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1000140296"
variation 1900
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969814009"
variation 1901
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1277993215"
variation 1902
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:374158106"
variation 1903
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1600401748"
variation 1904
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1568372076"
variation 1906
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969813767"
variation 1908
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:183070042"
variation 1909
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:368566805"
variation 1911
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1043985969"
variation 1912
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1436361103"
variation 1913
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:374485363"
variation 1918
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969813425"
variation 1919
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1568372057"
variation 1921
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1969813336"
variation 1923
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1300227627"
variation 1925
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969813253"
variation 1927
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969813218"
variation 1928
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1337749529"
variation 1929
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1214152290"
variation 1931
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1390205515"
variation 1936
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1304818760"
variation 1937
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:7245658"
variation 1938
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:889762821"
variation 1941
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1215501542"
variation 1943
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1969812787"
variation 1944
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969812746"
variation 1945
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1969812705"
variation 1948
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1251125768"
variation 1949
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1405400899"
variation 1950
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1049721313"
variation 1953
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1445053050"
variation 1954
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1969812466"
variation 1956
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:934057092"
variation 1960
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1243585856"
variation 1962
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1969812313"
variation 1964
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969812263"
variation 1965
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1969812212"
variation 1968
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:529617493"
variation 1969
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:2122226082"
variation 1971
/gene="PSG8"
/gene_synonym="PSG1"
/replace=""
/replace="a"
/db_xref="dbSNP:1413909821"
variation 1971
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:7246644"
variation 1972
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1600401633"
variation 1973
/gene="PSG8"
/gene_synonym="PSG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:1600401626"
variation 1975
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969811868"
variation 1976
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1462619069"
variation 1978
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969811827"
variation 1979
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:148329713"
variation 1980
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1268690554"
variation 1984
/gene="PSG8"
/gene_synonym="PSG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:1969811663"
variation 1985
/gene="PSG8"
/gene_synonym="PSG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:144318143"
ORIGIN
agaaggaggcaggacagcactgctgagagctgtgctcaggaagcttctggatcctaggctcatctccacagaggagaacacacagacagcagagaccatggggctcctctcagcccctccctgcacacagcgcatcacctggaaggggctcctgctcacaggtcattccttggactctgctctatctttagaggtcactggctcaagtcagccactatgagacacctgggaaaactgcgccaccttgtggctccactgcctgatgactgaactgacctccggacttgactctgttctcccctgtgttatttctgctgaagtacccagtcccaggccaggctttccagtacccaaagggtttaaagacaattggaagttccatcacccatctctaggatgtccttggcaagggaagctgcagagaaaacataccttgggcggcaaagtaagactgaaactaagaagattccagcactgcatgctccaatggagactcccaagccctccatctccagcagcaaattaaaccccagggaggccatggaggctgtgagcttaacctgtgatcctgagactccggacgcaagctacctgtggtggatgaatggtcagagcctccctatgtctcacaggttgcagttgtctgaaaccaacaggaccctctttctattgggtgtcacaaagtacactgcaggaccctatgaatgtgaaatacggaacccagtgagtgccagccgcagtgacccattcaccctgaatctcctcccgaagctgcccaagccctacatcaccatcaacaacttaaaacccagggagaataaggatgtcttaaacttcacctgtgaacctaagagtgagaactacacctacatttggtggctaaatggtcagagcctcccggtcagtcccagggtaaagcgacccattgaaaacaggatcctcattctacccagtgtcacgagaaatgaaacaggaccctatcaatgtgaaataagggaccaatatggtggcatccgcagttacccagtcaccctgaatgtcctctatggtccagacctccccagaatttacccttcattcacctattaccgttcaggagaagtcctctacttgtcctgttctgcggactctaacccaccggcacagtattcttggacaattaatgggaagtttcagctatcaggacaaaagctctttatcccccaaattactacaaagcatagcgggctctatgcttgctctgttcgtaactcagccactggcaaggaaagctccaaatccatgacagtaaaagtctctgactggacattaccctgaattctactagttcctccaattccattttcttccatggaatcgctaagaaaaagacccactctgttccagaagccctataagctggaggtggacaactcaatgtaaatttcatgggaaaacccttgtacctgaagggtgagccactcagaactcactaaaatgttcgacaccataacaacagatgctcaaactgtaaaccaggacaacaagtggatgacttcacactgtggacagtttttcccaagatgtcagaacaagactccccatcatgatgaggctctcacccctcttaactgtccttgctcatgcctgcctctttcacttggcaggataatgcagtcattagaatttcacatgtagtagcttctgagggtaacaatagagtgtcagatatgtcatctcaacccaaacttttacataacatctcagggggaaatgtggctctctccaccttgcatacaggactcccaatagaaatgaacacagagatattgcccgtgtgtttgcagataagatggtttctatgaagaggtaggaaagctgaaattataatagagtcccctttaaatgcacattctgtggatggctctcgccatttcctaagagatacattgtaaaatgtgacagtaatactgattctagcagaataaaacatgtaccacatttgctaatac
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]