ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2024-05-08 04:26:45, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_047422664 2996 bp mRNA linear PRI 05-OCT-2023
DEFINITION PREDICTED: Homo sapiens solute carrier family 27 member 4
(SLC27A4), transcript variant X1, mRNA.
ACCESSION XM_047422664
VERSION XM_047422664.1
DBLINK BioProject: PRJNA168
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NC_000009.12) annotated using gene prediction method: Gnomon,
supported by mRNA and EST evidence.
Also see:
Documentation of NCBI's Annotation Process
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI RefSeq
Annotation Status :: Updated annotation
Annotation Name :: GCF_000001405.40-RS_2023_10
Annotation Pipeline :: NCBI eukaryotic genome annotation
pipeline
Annotation Software Version :: 10.2
Annotation Method :: Best-placed RefSeq; Gnomon;
RefSeqFE; cmsearch; tRNAscan-SE
Features Annotated :: Gene; mRNA; CDS; ncRNA
Annotation Date :: 10/02/2023
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..2996
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="9"
gene 1..2996
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/note="solute carrier family 27 member 4; Derived by
automated computational analysis using gene prediction
method: Gnomon. Supporting evidence includes similarity
to: 3 mRNAs, 26 ESTs, 337 long SRA reads, 16 Proteins, and
100% coverage of the annotated genomic feature by RNAseq
alignments, including 7 samples with support for all
annotated introns"
/db_xref="GeneID:10999"
/db_xref="HGNC:HGNC:10998"
/db_xref="MIM:604194"
misc_feature 1
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/experiment="COORDINATES: cap analysis [ECO:0007248]"
/note="transcription start site"
variation 1
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:757916404"
variation 2
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:747006217"
variation 6
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1242934546"
variation 13
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832586984"
variation 19
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:924823027"
variation 20..25
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="ga"
/replace="gattga"
/db_xref="dbSNP:761226424"
variation 20
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:757243404"
variation 21
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:745994844"
variation 22
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:934845802"
variation 26
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:775831921"
variation 27
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832587323"
variation 28..32
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="ag"
/replace="aggag"
/db_xref="dbSNP:1322214698"
variation 28
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:749441434"
variation 30
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1431996395"
variation 32
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1283943812"
variation 33
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1832587542"
variation 34
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832587584"
variation 39
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:769075659"
variation 42
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:2131248517"
variation 43
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1171038568"
variation 44
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:774686107"
variation 45
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:768016213"
variation 47
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:773549906"
variation 49
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:536561595"
variation 50
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:752432512"
CDS 53..2017
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/codon_start=1
/product="long-chain fatty acid transport protein 4
isoform X1"
/protein_id="XP_047278620.1"
/db_xref="GeneID:10999"
/db_xref="HGNC:HGNC:10998"
/db_xref="MIM:604194"
/translation="
MRRAPPICIATMLLGASLVGVLLFSKLVLKLPWTQVGFSLLFLYLGSGGWRFIRVFIKTIRRDIFGGLVLLKVKAKVRQCLQERRTVPILFASTVRRHPDKTALIFEGTDTHWTFRQLDEYSSSVANFLQARGLASGDVAAIFMENRNEFVGLWLGMAKLGVEAALINTNLRRDALLHCLTTSRARALVFGSEMASAICEVHASLDPSLSLFCSGSWEPGAVPPSTEHLDPLLKDAPKHLPSCPDKGFTDKLFYIYTSGTTGLPKAAIVVHSRYYRMAALVYYGFRMRPNDIVYDCLPLYHSAGNIVGIGQCLLHGMTVVIRKKFSASRFWDDCIKYNCTIVQYIGELCRYLLNQPPREAENQHQVRMALGNGLRQSIWTNFSSRFHIPQVAEFYGATECNCSLGNFDSQVGACGFNSRILSFVYPIRLVRVNEDTMELIRGPDGVCIPCQPGEPGQLVGRIIQKDPLRRFDGYLNQGANNKKIAKDVFKKGDQAYLTGDVLVMDELGYLYFRDRTGDTFRWKGENVSTTEVEGTLSRLLDMADVAVYGVEVPGTEGRAGMAAVASPTGNCDLERFAQVLEKELPLYARPIFLRLLPELHKTGTYKFQKTELRKEGFDPAIVKDPLFYLDAQKGRYVPLDQEAYSRIQAGEEKL"
misc_feature 380..1909
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/note="Fatty acid transport proteins (FATP), including
FATP4 and FATP1, and similar proteins; Region:
hsFATP4_like; cd05939"
/db_xref="CDD:341262"
misc_feature order(812..814,821..838,842..847)
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/note="acyl-activating enzyme (AAE) consensus motif; other
site"
/db_xref="CDD:341262"
misc_feature order(821..823,1166..1171,1229..1246,1550..1552,
1586..1588,1595..1597,1628..1630,1868..1870)
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/note="putative AMP binding site [chemical binding]; other
site"
/db_xref="CDD:341262"
misc_feature order(821..823,941..946,1112..1114,1118..1123,1130..1132,
1166..1171,1229..1246,1550..1552,1586..1588,1595..1597,
1619..1630,1811..1813)
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/note="putative active site [active]"
/db_xref="CDD:341262"
misc_feature order(941..943,1118..1123,1130..1132,1166..1168,
1619..1627,1784..1786,1811..1813)
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/note="putative CoA binding site [chemical binding]; other
site"
/db_xref="CDD:341262"
variation 54
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:762504445"
variation 56
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:368133236"
variation 59
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:575732162"
variation 60
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:145775973"
variation 62
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1188575807"
variation 63
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:781303153"
variation 64
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1588553378"
variation 66
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:750308658"
variation 67
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:113380207"
variation 68
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1160713696"
variation 70
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1832588539"
variation 71
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:749583673"
variation 73
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1588553402"
variation 75
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:2131248631"
variation 77
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:777302413"
variation 78
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="t"
/db_xref="dbSNP:1832588717"
variation 79
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1188223409"
variation 80
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:768667680"
variation 82
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1832601549"
variation 83
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:753867000"
variation 86
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:142366975"
variation 91
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832601634"
variation 92
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1250886899"
variation 95..111
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="ggagcctctctggtggg"
/replace="ggagcctctctggtgggagcctctctggtggg"
/db_xref="dbSNP:1832601685"
variation 98
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:587776375"
variation 102
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:779127083"
variation 106
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1331404300"
variation 109..113
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="ggggg"
/replace="gggggg"
/db_xref="dbSNP:1336441841"
variation 109
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1435842473"
variation 112
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832602011"
variation 113
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:941992702"
variation 114
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1588553997"
variation 121
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1273355497"
variation 124
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1832602243"
variation 129
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:774441905"
variation 130
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1234805921"
variation 131
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1037629923"
variation 134
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1564398159"
variation 142
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:369914046"
variation 143
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:374100993"
variation 145
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1218177045"
variation 147
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:747605672"
variation 148
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:771351557"
variation 149
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832602821"
variation 151
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832602876"
variation 153
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1196110578"
variation 154
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832602965"
variation 155
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1254545362"
variation 156
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:777159527"
variation 157
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832603143"
variation 158
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832603183"
variation 163
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1564398180"
variation 165
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="t"
/db_xref="dbSNP:762577878"
variation 168
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:768263866"
variation 170
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:774190692"
variation 171..177
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="tgtt"
/replace="tgttgtt"
/db_xref="dbSNP:1832603439"
variation 171
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1832603391"
variation 176
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="t"
/db_xref="dbSNP:761554439"
variation 179
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832603536"
variation 181
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:767403653"
variation 183
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:772897914"
variation 184
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:916461343"
variation 188
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1463749326"
variation 189
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:200326645"
variation 192
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:760453701"
variation 195
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:766257677"
variation 196
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:753724861"
variation 197
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:772898726"
variation 199
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:761973333"
variation 203
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:201114376"
variation 204
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:777991347"
variation 205
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:757595854"
variation 210
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1207590505"
variation 212
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:781601074"
variation 213
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:746350316"
variation 216
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1588554095"
variation 221
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1207727769"
variation 225
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:768351833"
variation 226
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:773986481"
variation 227
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1427170851"
variation 229
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:747605541"
variation 232
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832605123"
variation 233
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:771629483"
variation 237
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:965117658"
variation 238
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:151270996"
variation 239
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1396806009"
variation 242
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:376918908"
variation 243
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:529797237"
variation 247
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1327395526"
variation 248
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1412106944"
variation 250
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:762085131"
variation 251
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1260284783"
variation 252
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:140481562"
variation 253
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:181020996"
variation 254
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:754345934"
variation 255
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1420895635"
variation 256
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1160107544"
variation 258..264
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="tcct"
/replace="tcctcct"
/db_xref="dbSNP:1832634654"
variation 259
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832634692"
variation 261
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:2131253130"
variation 266
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:757885764"
variation 269
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:752720767"
variation 270..271
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace=""
/replace="tca"
/db_xref="dbSNP:771244989"
variation 271
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832634893"
variation 274
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1270812749"
variation 275
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:528948129"
variation 281
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1564398904"
variation 283
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1192590239"
variation 284..285
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace=""
/replace="tcctgaaggtgaa"
/db_xref="dbSNP:1488498572"
variation 284
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:777331355"
variation 285
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:746695039"
variation 289
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:770580187"
variation 290
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1374887477"
variation 291
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1832635398"
variation 297
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:2131253198"
variation 301
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:780753073"
variation 302
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:202102875"
variation 303
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:769558665"
variation 304
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:370325524"
variation 305
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:762947585"
variation 306
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1348986026"
variation 307
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:2131253239"
variation 310
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:768679929"
variation 311
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1193226508"
variation 312
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1832635857"
variation 313
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:774503026"
variation 314
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:761732097"
variation 317
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:932617974"
variation 318
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1049633730"
variation 319
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:374284965"
variation 322
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:755778940"
variation 325
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1266990045"
variation 326
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832636230"
variation 328
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832636283"
variation 332
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1452845680"
variation 333
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1588555682"
variation 334
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:767885744"
variation 335
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:587776372"
variation 338
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:150462602"
variation 339
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:754370699"
variation 340
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:755497027"
variation 341
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:779226198"
variation 342
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:751081479"
variation 345
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:756713912"
variation 346
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:745491506"
variation 349..352
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="cgac"
/db_xref="dbSNP:1832637066"
variation 349
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:755972169"
variation 350
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:377410741"
variation 351
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:2131253384"
variation 354
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1015832821"
variation 357
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:138443340"
variation 358
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:376025892"
variation 359
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:137853132"
variation 361
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:774116130"
variation 365
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:748282554"
variation 369
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:772254154"
variation 370
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:773606505"
variation 371
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1039014362"
variation 373
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:760973751"
variation 375
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1448709376"
variation 382
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:371922995"
variation 385
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:2131253449"
variation 386
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:376775679"
variation 387
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1564399000"
variation 394
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1026685546"
variation 398
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:369725225"
variation 399
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:142664086"
variation 400
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:756803261"
variation 401
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:767013913"
variation 402
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:750137383"
variation 404
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:748034205"
variation 406
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:755781288"
variation 410
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:779506515"
variation 415
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1287517728"
variation 418
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:2131253516"
variation 421
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1564399028"
variation 423
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:372549619"
variation 424
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:754681667"
variation 425
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832638617"
variation 429
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832638660"
variation 430
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:778960295"
variation 432..433
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace=""
/replace="ttggagc"
/db_xref="dbSNP:777016565"
variation 432
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1332852187"
variation 433
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1235195368"
variation 434..435
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace=""
/replace="ctctgg"
/db_xref="dbSNP:759136170"
variation 435
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="t"
/db_xref="dbSNP:1274089475"
variation 436
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832638983"
variation 437
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:587776376"
variation 439
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1286207840"
variation 441
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:146902785"
variation 443
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1213864537"
variation 446
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:772343794"
variation 447
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:56224008"
variation 449
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:747027095"
variation 452
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:771184494"
variation 455
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832639503"
variation 458
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1475936108"
variation 459
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:776673572"
variation 460
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1410819650"
variation 462
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832639691"
variation 463
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:759965140"
variation 464
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:149240794"
variation 466
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1412114835"
variation 474
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1588555912"
variation 475
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832639989"
variation 476
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1000822737"
variation 481
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:777803494"
variation 482
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:979492737"
variation 483
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832640192"
variation 484..573
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="ggagaaccgcaatgagttcgtgggcctatggctgggcatggccaagct
cggtgtggaggcagccctcatcaacaccaacctgcggcggga"
/replace="ggagaaccgcaatgagttcgtgggcctatggctgggcatggccaagct
cggtgtggaggcagccctcatcaacaccaacctgcggcgggagaaccgcaatgagttc
gtgggcctatggctgggcatggccaagctcggtgtggaggcagccctcatcaacacca
acctgcggcggga"
/db_xref="dbSNP:1832640238"
variation 486
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="t"
/db_xref="dbSNP:1421931391"
variation 490
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1832640348"
variation 491
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:763440162"
variation 492
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:148684713"
variation 495
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:749944564"
variation 496
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:142183053"
variation 497
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832640626"
variation 499
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:959279096"
variation 500
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:747250280"
variation 502
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:771099337"
variation 503
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:778567260"
variation 504
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:752738523"
variation 505
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832641017"
variation 508
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:368927624"
variation 511
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:777782415"
variation 517
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:373461078"
variation 528
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:144423836"
variation 530
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1314148176"
variation 531
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1386244414"
variation 532
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:770864785"
variation 533
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:148013164"
variation 534
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1231826203"
variation 535
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="t"
/db_xref="dbSNP:141658118"
variation 536
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:146003017"
variation 539
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:775849865"
variation 542
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:896972625"
variation 544
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:776862021"
variation 546
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:763240946"
variation 547
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832641771"
variation 548
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1373980406"
variation 551
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832641868"
variation 555
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1388943781"
variation 558..559
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace=""
/replace="tt"
/db_xref="dbSNP:764813721"
variation 558
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:769183616"
variation 560
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="t"
/db_xref="dbSNP:774792455"
variation 561
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1313962471"
variation 562
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:760282389"
variation 563
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:765777510"
variation 564
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1455995449"
variation 565
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832642338"
variation 566
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:753590802"
variation 567
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:199612630"
variation 568
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1165461682"
variation 569
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:764884901"
variation 570
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:752544255"
variation 571
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1832642665"
variation 572
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:758222506"
variation 573
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:777872164"
variation 575
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:983183281"
variation 577..605
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="tctgctccactgcctcaccacctcgcgcg"
/replace="tctgctccactgcctcaccacctcgcgcgtctgctccactgcctcacc
acctcgcgcg"
/db_xref="dbSNP:774986938"
variation 577
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:139914381"
variation 578
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832642983"
variation 581
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1233138411"
variation 585
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:905588362"
variation 588
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1465467620"
variation 589
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:137853131"
variation 590
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1400883465"
variation 591
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832643284"
variation 593
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1191312734"
variation 594
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1393676773"
variation 598
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:587776377"
variation 600
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:745905373"
variation 601
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:769915825"
variation 602
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1396393423"
variation 603
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:146266746"
variation 604
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:587776378"
variation 605
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:139712194"
variation 606
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1588556130"
variation 607
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1675695042"
variation 608
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:587776379"
variation 609
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:550881707"
variation 611
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1372996668"
variation 614
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1832643941"
variation 615..616
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1234731044"
variation 617
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1269572706"
variation 619
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:149776553"
variation 623
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1832644130"
variation 624
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832644167"
variation 625
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1216212484"
variation 628
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:185999764"
variation 629
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:770042965"
variation 634
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:370438615"
variation 635
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1211449546"
variation 636
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1254491310"
variation 637
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1470157788"
variation 644
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:773728334"
variation 646
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1329626843"
variation 647
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:112690666"
variation 648
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:769402201"
variation 649
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:775319745"
variation 655
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832690183"
variation 657
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:148956936"
variation 658
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1349056404"
variation 660
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1832690306"
variation 662
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832690345"
variation 664
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:763783773"
variation 665
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:569192295"
variation 669
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1588558659"
variation 672
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:761633153"
variation 675
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:767381674"
variation 676
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:145438251"
variation 677
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1424406721"
variation 679
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:910754754"
variation 680
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832690769"
variation 681
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1181450214"
variation 682
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:756227455"
variation 685
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:766443539"
variation 690
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:200652957"
variation 696
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:755205261"
variation 697
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1832690983"
variation 698
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:779039125"
variation 700
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:147730773"
variation 703
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1379347201"
variation 706
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1832691151"
variation 709
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:758737198"
variation 710
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:2240953"
variation 714
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:146913469"
variation 715
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1240367045"
variation 719
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1310472468"
variation 720
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1564400408"
variation 722
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:769493917"
variation 729
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:775155870"
variation 735
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832691601"
variation 736
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1283088303"
variation 737
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832691668"
variation 739
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1241070196"
variation 744
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832691749"
variation 747
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:934737699"
variation 749
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1195284143"
variation 751
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1832691902"
variation 754
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:748741914"
variation 755
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace=""
/replace="g"
/db_xref="dbSNP:1454701735"
variation 758
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:374877285"
variation 759
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1832692077"
variation 763
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:941760108"
variation 765
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1588558757"
variation 769
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:774007031"
variation 770
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:761566381"
variation 772
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:2131259210"
variation 773..775
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="cc"
/replace="ccc"
/db_xref="dbSNP:1318202531"
variation 780
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1452269399"
variation 782
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1375260725"
variation 783
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:192211964"
variation 787
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:773093434"
variation 789..790
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace=""
/replace="ag"
/db_xref="dbSNP:763582559"
variation 790
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:770160175"
variation 791
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:766244848"
variation 792
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:200058177"
variation 793
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832692729"
variation 794
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1419927523"
variation 797
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:376201304"
variation 798
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1011889783"
variation 801
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:781777034"
variation 805
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="t"
/db_xref="dbSNP:750933141"
variation 808
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:754515886"
variation 811
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:779448060"
variation 814
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1588559798"
variation 815
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:956490024"
variation 817
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:560930048"
variation 823
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:747557571"
variation 824
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:137853133"
variation 825
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1477677573"
variation 826
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:771758594"
variation 827
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832713957"
variation 828
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1190970715"
variation 834
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832714032"
variation 835
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:2131261420"
variation 838
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:2131261424"
variation 839
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832714065"
variation 841
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:777248422"
variation 842
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832714108"
variation 850
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:746825516"
variation 851
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1292771303"
variation 852
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:770686607"
variation 853
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:776589408"
variation 854
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1290850640"
variation 856
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:759464276"
variation 857
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:769821518"
variation 858
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1832714554"
variation 859
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:762903317"
variation 863
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1832714642"
variation 864
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:764401643"
variation 865
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1233849313"
variation 871
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1440691306"
variation 873
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1410491840"
variation 873
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1173622438"
variation 874
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="t"
/db_xref="dbSNP:1162638030"
variation 875
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1393780849"
variation 878
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:762116764"
variation 879
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:767793401"
variation 886
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:369259655"
variation 887
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:17848330"
variation 889
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:757961846"
variation 890
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1055998963"
variation 892
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:2131261732"
variation 893
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1462777232"
variation 894
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1003408443"
variation 898
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1233278176"
variation 899
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832718597"
variation 900
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:139365286"
variation 903
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:372544813"
variation 904
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="t"
/db_xref="dbSNP:2131261766"
variation 908
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:587776380"
variation 909
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:780754811"
variation 910
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832718854"
variation 911
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="t"
/db_xref="dbSNP:745700600"
variation 913
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:565283052"
variation 914
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:780081673"
variation 915
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1458529052"
variation 916
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1193360198"
variation 921
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:749178606"
variation 922
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:376203527"
variation 923
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:774589847"
variation 926
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1418901826"
variation 928
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832719317"
variation 929
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:892304434"
variation 933
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1231329433"
variation 934
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1173169589"
variation 937
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:748175622"
variation 939
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1440393605"
variation 940
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1047591235"
variation 941
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1323669438"
variation 942
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="t"
/db_xref="dbSNP:1564401146"
variation 943..947
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="ccccc"
/replace="ccccccc"
/db_xref="dbSNP:1832719728"
variation 943
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:527646237"
variation 946
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:369193438"
variation 947
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:191620324"
variation 948..951
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace=""
/replace="tcta"
/db_xref="dbSNP:755253300"
variation 951
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:184610255"
variation 953
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:777257728"
variation 955
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1258345822"
variation 957
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1832720048"
variation 960
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1333746712"
variation 961
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832720112"
variation 967
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:560423639"
variation 968
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1351876154"
variation 970
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:767010123"
variation 971
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:778601619"
variation 973
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832754134"
variation 977
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832754164"
variation 979
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:140588587"
variation 980
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1053889627"
variation 984
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:137853134"
variation 988
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1174837326"
variation 991
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1564401858"
variation 992
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:889862602"
variation 994
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:753609874"
variation 996
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832754461"
variation 997
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:754774167"
variation 1001
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="t"
/db_xref="dbSNP:150297777"
variation 1002
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:752648305"
variation 1005
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:758614110"
variation 1006..1012
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="ggtg"
/replace="ggtggtg"
/db_xref="dbSNP:1564401878"
variation 1006
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:777697758"
variation 1009
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:747052313"
variation 1011
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1588561919"
variation 1012
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1759289550"
variation 1016
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1394381964"
variation 1017
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:771809233"
variation 1020
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1304113474"
variation 1024
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:781434521"
variation 1030
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1390466132"
variation 1032
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1006921491"
variation 1033
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1019626628"
variation 1035
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:532636378"
variation 1037
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:374003386"
variation 1038
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:183345361"
variation 1039
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1345449525"
variation 1042
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:749783583"
variation 1048
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:73614128"
variation 1049
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:772605722"
variation 1054
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832755687"
variation 1055
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832755733"
variation 1056
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:2131264973"
variation 1063
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1832755785"
variation 1065
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832755830"
variation 1070
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1352607450"
variation 1071
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:760194495"
variation 1072
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:765973155"
variation 1075
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1399890950"
variation 1081
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1276410838"
variation 1083
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832760674"
variation 1084
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:775430036"
variation 1085
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:762769153"
variation 1086
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1312260859"
variation 1087
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:763958515"
variation 1093
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1223456388"
variation 1100
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:376823464"
variation 1101
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1025586270"
variation 1103
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:767622112"
variation 1104
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:750445884"
variation 1105
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832761204"
variation 1115
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1477861155"
variation 1117..1124
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="gc"
/replace="gccaccgc"
/db_xref="dbSNP:1207319089"
variation 1119
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832761317"
variation 1120
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:55976774"
variation 1122
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1411152989"
variation 1123
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1005419769"
variation 1124
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:770921425"
variation 1125
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:749677544"
variation 1132
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:958492814"
variation 1137
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:111417655"
variation 1142
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1832761681"
variation 1144
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:779325951"
variation 1146
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1400663450"
variation 1147
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1349445756"
variation 1148
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1832761850"
variation 1149..1150
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="t"
/replace="tt"
/db_xref="dbSNP:777972512"
variation 1151
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:902732348"
variation 1152
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:748681195"
variation 1154
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:770401141"
variation 1156
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:2131265577"
variation 1157
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:374056113"
variation 1158
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1352625035"
variation 1162
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1237956193"
variation 1167
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:967034756"
variation 1171
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:745308991"
variation 1175
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:977472472"
variation 1176
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:769600924"
variation 1184
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1484044403"
variation 1185
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1447137227"
variation 1186
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:377518799"
variation 1194
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:775231744"
variation 1199
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:77188162"
variation 1200..1201
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="cc"
/replace="ccc"
/db_xref="dbSNP:1832762573"
variation 1203..1207
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="gc"
/replace="gccgc"
/db_xref="dbSNP:747506439"
variation 1203
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1439455555"
variation 1205
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:768495407"
variation 1206
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:747613867"
variation 1207
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:764004676"
variation 1212
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:187433964"
variation 1217
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:2131265675"
variation 1218
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:761823526"
variation 1219
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1333617664"
variation 1221
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:936910156"
variation 1225
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1241248082"
variation 1231
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1255624398"
variation 1236
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:562299414"
variation 1237
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:760700892"
variation 1238
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:751505867"
variation 1240
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:369770881"
variation 1243
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832763512"
variation 1246
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:2131265726"
variation 1249
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1444282448"
variation 1250
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832763629"
variation 1252
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:755361442"
variation 1253
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:779320915"
variation 1254
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1832763795"
variation 1259
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1229911991"
variation 1261
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:752943410"
variation 1263
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1708371988"
variation 1266
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1588562385"
variation 1267
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace=""
/replace="c"
/db_xref="dbSNP:1798735068"
variation 1267
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1041171329"
variation 1273
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:758945421"
variation 1274
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:778382495"
variation 1280
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:745391195"
variation 1284
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1266145147"
variation 1285
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:372158557"
variation 1289
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1588562566"
variation 1290
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:746931919"
variation 1292
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:770792971"
variation 1293
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:2131266064"
variation 1296..1300
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace=""
/replace="gtttc"
/db_xref="dbSNP:1832767186"
variation 1296
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1220159176"
variation 1297
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:776774693"
variation 1300
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1227551235"
variation 1302
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:759491973"
variation 1305
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace=""
/replace="g"
/db_xref="dbSNP:1299776780"
variation 1307
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:375523225"
variation 1308
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:775550483"
variation 1309
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:763450906"
variation 1318
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:145969067"
variation 1320
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:751914757"
variation 1321
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:757846177"
variation 1322
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:367871179"
variation 1324
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832767721"
variation 1328
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:753413853"
variation 1333
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1373826093"
variation 1334
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:138701018"
variation 1335
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:778672007"
variation 1343
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:151123708"
variation 1344
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:546174669"
variation 1345
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:777554007"
variation 1348
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:550431851"
variation 1350
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1358138536"
variation 1351
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:746737522"
variation 1352
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:566260231"
variation 1354
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:572373105"
variation 1358
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1242102112"
variation 1359
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1282805763"
variation 1360
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1435921628"
variation 1368
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:746006894"
variation 1370
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="t"
/db_xref="dbSNP:1247440634"
variation 1372
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1285915285"
variation 1373
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:376890663"
variation 1374
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:141731313"
variation 1375
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832768840"
variation 1376
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:775848072"
variation 1377
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:763282279"
variation 1378
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:372416208"
variation 1381
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:762221085"
variation 1382
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:768121652"
variation 1383
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1588562727"
variation 1384
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:78415617"
variation 1385..1392
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="ggcgtctg"
/db_xref="dbSNP:776876314"
variation 1385
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:750866973"
variation 1387
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:548945242"
variation 1388
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:148488076"
variation 1392
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:752141064"
variation 1394
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832770255"
variation 1398
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:201906435"
variation 1404
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="t"
/db_xref="dbSNP:1431553581"
variation 1405
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1470549158"
variation 1406..1407
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="cc"
/replace="ccc"
/db_xref="dbSNP:746178942"
variation 1406
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1400471096"
variation 1407
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1832770590"
variation 1411
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:751179445"
variation 1413
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1477291443"
variation 1415
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:868259567"
variation 1416
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1168085285"
variation 1417
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:757141833"
variation 1419..1435
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="gccagctggtgggccgc"
/replace="gccagctggtgggccgcgccagctggtgggccgc"
/db_xref="dbSNP:912686983"
variation 1419
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1832796316"
variation 1420
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:750166939"
variation 1426
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:980340110"
variation 1427
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1199067106"
variation 1428
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1588564371"
variation 1429
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1461010824"
variation 1431
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:756038092"
variation 1432
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1385548443"
variation 1433
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:780093092"
variation 1434
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:749429635"
variation 1439
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="t"
/db_xref="dbSNP:1218324957"
variation 1441
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:768827874"
variation 1442
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:2131268513"
variation 1443
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1309094631"
variation 1450
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:921911025"
variation 1451
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1832797047"
variation 1453
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:779347193"
variation 1456
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1337167580"
variation 1457
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:748309868"
variation 1458
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1211491808"
variation 1459
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1404814419"
variation 1460
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:931994910"
variation 1461
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:368919168"
variation 1465
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:773449802"
variation 1466
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:761056845"
variation 1475
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1428701833"
variation 1477
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1275115542"
variation 1479
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:558640688"
variation 1487
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:771361561"
variation 1489..1497
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="caacaa"
/replace="caacaacaa"
/db_xref="dbSNP:775182777"
variation 1490
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:777098482"
variation 1491
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:141763664"
variation 1492
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:867261956"
variation 1493
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:909296584"
variation 1494
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1366339307"
variation 1495
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:150834858"
variation 1496..1502
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="aaga"
/replace="aagaaga"
/db_xref="dbSNP:762561274"
variation 1498
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:774047091"
variation 1502
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:139251313"
variation 1506
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:2131268645"
variation 1508
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="t"
/db_xref="dbSNP:1254410886"
variation 1513
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:145475190"
variation 1514
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1215323148"
variation 1515
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="t"
/db_xref="dbSNP:147688821"
variation 1516
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:200670378"
variation 1517..1518
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1564403065"
variation 1524
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1312424401"
variation 1525
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:587776382"
variation 1526
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:753826536"
variation 1527
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:755169878"
variation 1529
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:779152686"
variation 1531
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1213865424"
variation 1532
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1340721389"
variation 1533
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832798866"
variation 1536
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1243293649"
variation 1540
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:748188422"
variation 1545
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1316974602"
variation 1546..1547
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace=""
/replace="tg"
/db_xref="dbSNP:763625583"
variation 1547
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1180852845"
variation 1549
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1375788890"
variation 1550
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1444560411"
variation 1552
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:747248620"
variation 1555
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1294267848"
variation 1558
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:201552447"
variation 1559
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1218102341"
variation 1561
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:140779194"
variation 1562
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1588564806"
variation 1564
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:2131269019"
variation 1567
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:781348123"
variation 1568
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:745772780"
variation 1571
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:2131269037"
variation 1577
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:776044326"
variation 1584
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="t"
/db_xref="dbSNP:144844009"
variation 1585
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:772801537"
variation 1589
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:587776384"
variation 1590
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:373529558"
variation 1595
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:770645288"
variation 1596
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:776594920"
variation 1599
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1427218192"
variation 1600
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832803801"
variation 1602
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832803836"
variation 1604
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:377473129"
variation 1606
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1832803988"
variation 1608
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:765311079"
variation 1609
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:752647187"
variation 1611
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1463848003"
variation 1612
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1220516513"
variation 1613
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:763007838"
variation 1614
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:764219842"
variation 1617
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:969050385"
variation 1621
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1435616652"
variation 1622
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:751534131"
variation 1624
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1480491043"
variation 1626
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:763917127"
variation 1627
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:757475140"
variation 1630
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:2240952"
variation 1631
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:750837144"
variation 1634
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:2131269140"
variation 1636
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:780494359"
variation 1637
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:2131269149"
variation 1638
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832804828"
variation 1640
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:749791442"
variation 1642
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:768990519"
variation 1643
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1438912227"
variation 1644
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832804990"
variation 1645
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:374740669"
variation 1654
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:746482901"
variation 1655
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1490857350"
variation 1657
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:770726802"
variation 1658
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:759441998"
variation 1659
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832805288"
variation 1660
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:587776373"
variation 1663..1664
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="cc"
/replace="ccc"
/db_xref="dbSNP:1259764712"
variation 1664
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:373143772"
variation 1665
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:200595810"
variation 1667
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:376849982"
variation 1668
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1832805589"
variation 1673
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1832805631"
variation 1675
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1564403289"
variation 1676
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:763870431"
variation 1677
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1443222324"
variation 1679
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:751670175"
variation 1680
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1366945831"
variation 1681
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1832805888"
variation 1684
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:371165384"
variation 1685
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:374720830"
variation 1686
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1337991577"
variation 1688
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1432384009"
variation 1690
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:750641063"
variation 1691
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:540906829"
variation 1692
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1361013060"
variation 1693..1703
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="gtatggtgtcg"
/db_xref="dbSNP:1228311616"
variation 1693
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1832806289"
variation 1694
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:149009661"
variation 1695
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1290193175"
variation 1697
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:780482793"
variation 1699
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1588565053"
variation 1702
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:143813674"
variation 1703
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:763116146"
variation 1706
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:947507561"
variation 1708
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1195517885"
variation 1711
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:779234366"
variation 1712
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:200136301"
variation 1715
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1036256284"
variation 1716
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1401095556"
variation 1717
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1271004202"
variation 1718
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:756888086"
variation 1723
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:899024495"
variation 1724
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1360036526"
variation 1725
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:774422594"
variation 1729
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:745315171"
variation 1730..1731
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="gg"
/db_xref="dbSNP:750320778"
variation 1730
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832809026"
variation 1733
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:755822737"
variation 1734
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1300551408"
variation 1736
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1454051167"
variation 1737
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:779524723"
variation 1739
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832809295"
variation 1740
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1334096498"
variation 1742
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1241310900"
variation 1745
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1280158959"
variation 1751
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:201575519"
variation 1752
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:150944027"
variation 1754..1763
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace=""
/replace="actggcaact"
/db_xref="dbSNP:756026778"
variation 1754
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1588565333"
variation 1755
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1201931863"
variation 1756
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:768330554"
variation 1758
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:774328999"
variation 1759
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:374065495"
variation 1761
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:771927403"
variation 1763
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:545105104"
variation 1768
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1181935242"
variation 1769
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:760618552"
variation 1775
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:200769384"
variation 1776
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:372044915"
variation 1777
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:565010380"
variation 1783
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:760016337"
variation 1785
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:765686527"
variation 1791
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:753055258"
variation 1794
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1393585010"
variation 1796
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:369542828"
variation 1799
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832810546"
variation 1801
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1344958955"
variation 1804
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1003203297"
variation 1805..1808
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="ccc"
/replace="cccc"
/db_xref="dbSNP:1564403510"
variation 1805
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:11788921"
variation 1807
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1324053963"
variation 1808
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:749972589"
variation 1809
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1227018337"
variation 1812
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="t"
/db_xref="dbSNP:1249354997"
variation 1813
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1481584886"
variation 1815
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:755547852"
variation 1816
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:779823165"
variation 1817
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:201409856"
variation 1818
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:762232131"
variation 1819
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:140778286"
variation 1825
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1301901715"
variation 1829
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1588565467"
variation 1830
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1388886631"
variation 1831
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:778681416"
variation 1832
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832811501"
variation 1833
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:137853135"
variation 1834
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:144710786"
variation 1835
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:138603285"
variation 1838
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832811676"
variation 1844
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1168982404"
variation 1846
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1461132541"
variation 1847
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:141609871"
variation 1851
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832811823"
variation 1852
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1403148769"
variation 1857
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1304992408"
variation 1859
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:869312967"
variation 1866
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="t"
/db_xref="dbSNP:753307221"
variation 1867
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1315610392"
variation 1869
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:759020646"
variation 1870
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:764905781"
variation 1871
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="t"
/db_xref="dbSNP:1832880035"
variation 1872
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1308467455"
variation 1873
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:752347187"
variation 1874
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1832880223"
variation 1876
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1588569249"
variation 1877..1878
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="aa"
/db_xref="dbSNP:761215835"
variation 1881
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1410890321"
variation 1882..1885
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="ag"
/replace="agag"
/db_xref="dbSNP:758657421"
variation 1889
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:758250643"
variation 1890
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1460254394"
variation 1893
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1206163361"
variation 1895
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832880587"
variation 1896
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1238531438"
variation 1897
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1252895282"
variation 1900
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1209488031"
variation 1904
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:777446120"
variation 1906
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1564405100"
variation 1908
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:751304432"
variation 1909
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:757174951"
variation 1915
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1329099237"
variation 1916
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:781136695"
variation 1917
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:2131275653"
variation 1918
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1564405108"
variation 1921
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:746162043"
variation 1922
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:756231976"
variation 1923
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1588569307"
variation 1925
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:780481557"
variation 1926
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:760469432"
variation 1927
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:774607759"
variation 1930
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1031574550"
variation 1931
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1439846996"
variation 1933
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:770271326"
variation 1935
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:772501353"
variation 1937
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:773734372"
variation 1938
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832881686"
variation 1939
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1280934926"
variation 1943
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:759116823"
variation 1946
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1225755078"
variation 1947
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="t"
/db_xref="dbSNP:1832881868"
variation 1948
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1832881914"
variation 1949
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1832881963"
variation 1950
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="t"
/db_xref="dbSNP:1832882012"
variation 1953
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832882054"
variation 1955
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:374181475"
variation 1956
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:774925653"
variation 1958
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:780774044"
variation 1960
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:763764188"
variation 1961
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:771969323"
variation 1962
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="t"
/db_xref="dbSNP:1156678402"
variation 1963
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1461333542"
variation 1964
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:751335397"
variation 1965
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:199976408"
variation 1966
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:587776385"
variation 1968
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832882706"
variation 1971
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:780283479"
variation 1977
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1204437285"
variation 1979
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832882855"
variation 1980
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:766326461"
variation 1982
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:964821235"
variation 1983..1996
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace=""
/replace="acagccgcatccag"
/db_xref="dbSNP:1266849380"
variation 1983
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:749339037"
variation 1984
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:755175293"
variation 1985
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1832883146"
variation 1986
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1408193107"
variation 1988
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:779171579"
variation 1989
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:587776386"
variation 1990
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832883343"
variation 1991
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:376538306"
variation 1993
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1403771127"
variation 1994
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:772477474"
variation 1996
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:773769663"
variation 1998
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:747532616"
variation 2002
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:531498882"
variation 2003..2008
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="gag"
/replace="gaggag"
/db_xref="dbSNP:1312502881"
variation 2003
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:775015355"
variation 2008
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1376581492"
variation 2011
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1564405211"
variation 2012..2034
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="ctg"
/replace="ctgtgattccccccatccctctg"
/db_xref="dbSNP:1564405217"
variation 2012
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1339136800"
variation 2014
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1213370100"
variation 2017
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1275695543"
variation 2018
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1588569485"
variation 2020..2025
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="cccccc"
/replace="ccccccc"
/db_xref="dbSNP:2131275908"
variation 2020
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1410678053"
variation 2021
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:762401923"
variation 2023
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1221883906"
variation 2024
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1282644086"
variation 2026
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:763704508"
variation 2027
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="t"
/replace="tt"
/db_xref="dbSNP:993068439"
variation 2030
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1024176997"
variation 2031
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:774023645"
variation 2033
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:761580698"
variation 2033
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="t"
/replace="tt"
/db_xref="dbSNP:777740435"
variation 2034
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1241370183"
variation 2040
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:587777865"
variation 2041
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:138008274"
variation 2043
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:376796238"
variation 2044
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:754017632"
variation 2045
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832884882"
variation 2047
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="t"
/db_xref="dbSNP:1832884911"
variation 2048
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:925919728"
variation 2050
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:2131275995"
variation 2051
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1161152944"
variation 2052
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:755051651"
variation 2056
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:113904747"
variation 2057
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:752947632"
variation 2060..2078
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="gccccaggttccgccccag"
/replace="gccccaggttccgccccaggttccgccccag"
/db_xref="dbSNP:1832885236"
variation 2060
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:373964131"
variation 2061
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1265203687"
variation 2063
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1219877488"
variation 2064
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1429090998"
variation 2065
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:747337886"
variation 2066
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:201630443"
variation 2067
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:781649878"
variation 2071
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:867728194"
variation 2072
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:527573366"
variation 2073
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1363738933"
variation 2074
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832887255"
variation 2076
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832887287"
variation 2078
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1294805779"
variation 2081
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:77443393"
variation 2082
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1038941045"
variation 2083
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:566704264"
variation 2084
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:922148308"
variation 2085
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1164381847"
variation 2086
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832887611"
variation 2091
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:932214581"
variation 2094
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:556373512"
variation 2099
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1170620169"
variation 2116
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:535965221"
variation 2122
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1429596971"
variation 2125
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace=""
/replace="t"
/db_xref="dbSNP:1049315904"
variation 2128
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1564405302"
variation 2129
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1588569639"
variation 2130
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1044463300"
variation 2136
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1489637802"
variation 2137
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1588569645"
variation 2145
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832888225"
variation 2146
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="t"
/db_xref="dbSNP:907222850"
variation 2149
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1832888297"
variation 2150
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1249406111"
variation 2153..2156
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:1341044270"
variation 2153
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:549171857"
variation 2155
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832888650"
variation 2159
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832888693"
variation 2162
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1588569665"
variation 2164
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1229021567"
variation 2166
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832888797"
variation 2167
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1002862538"
variation 2171
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:753785165"
variation 2172
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:2131276199"
variation 2175
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1053058267"
variation 2180
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1217415690"
variation 2182
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:2131276208"
variation 2183
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:891716362"
variation 2184
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1011463205"
variation 2185
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1832889018"
variation 2186
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1021886970"
variation 2189
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:576195157"
variation 2190
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1303559869"
variation 2191
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1259533147"
variation 2194
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1368991792"
variation 2202
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:115745773"
variation 2205
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1462611913"
variation 2209
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:749788449"
variation 2212
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:538080431"
variation 2215
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832889412"
variation 2218
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:771728476"
variation 2220
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1429332115"
variation 2221
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1564405350"
variation 2225
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1036696656"
variation 2226
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:560729636"
variation 2227
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1354382501"
variation 2228
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1482504250"
variation 2229
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:983071120"
variation 2232
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1249246395"
variation 2236
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:770046973"
variation 2237
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1014032553"
variation 2241
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1832889883"
variation 2245
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:2131276323"
variation 2247
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1832889919"
variation 2250
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1832889963"
variation 2251
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1462807189"
variation 2255
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1832890002"
variation 2263
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1230917674"
variation 2265
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:56363747"
variation 2266
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1832890201"
variation 2266
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:145075109"
variation 2271
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:186434263"
variation 2272
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1832890289"
variation 2273
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832890341"
variation 2274
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:920108335"
variation 2275
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1588569780"
variation 2277
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:948898716"
variation 2281
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832890466"
variation 2282
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1001424550"
variation 2290
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832890607"
variation 2295
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1284034217"
variation 2297
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1044904502"
variation 2298
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1588569802"
variation 2299
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:957316223"
variation 2303
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1832890798"
variation 2304
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1588569812"
variation 2306
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1832890863"
variation 2308
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:928697087"
variation 2310
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1220886090"
variation 2313
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832891001"
variation 2316
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1293334613"
variation 2317
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:988806703"
variation 2320
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:938706835"
variation 2321
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:573529693"
variation 2322
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832891593"
variation 2323
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:891768597"
variation 2326
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:13295643"
variation 2327
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1419328979"
variation 2330
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1042954055"
variation 2331
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832891853"
variation 2332
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:542723715"
variation 2335
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1198271725"
variation 2337
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832891925"
variation 2341
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1588569861"
variation 2344
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832891982"
variation 2345
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832892012"
variation 2351
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:2131276520"
variation 2354
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832892051"
variation 2355
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1462593209"
variation 2358
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:900355214"
variation 2360
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1208044708"
variation 2365
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832892205"
variation 2366
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1489738905"
variation 2367
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1588569878"
variation 2369
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1221194481"
variation 2372
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:996008923"
variation 2375
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace=""
/replace="g"
/db_xref="dbSNP:1268995990"
variation 2379
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1489170063"
variation 2382
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832892471"
variation 2383
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="t"
/db_xref="dbSNP:759390553"
variation 2384
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1832892549"
variation 2388
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:890200821"
variation 2393
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:922067671"
variation 2395
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832892662"
variation 2396
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="t"
/db_xref="dbSNP:1832892691"
variation 2397
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1310621677"
variation 2398
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1454706926"
variation 2401
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1832892760"
variation 2409
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1832892793"
variation 2412
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:556019273"
variation 2413..2438
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="agtggtagcatccatctggtggccaa"
/db_xref="dbSNP:925305536"
variation 2413
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832892883"
variation 2414
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1456146955"
variation 2419
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:909465719"
variation 2421
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832892971"
variation 2426
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1832893012"
variation 2430
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832893063"
variation 2433
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832893099"
variation 2434
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1832893140"
variation 2437
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832893177"
variation 2438
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1159560787"
variation 2440
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:138863948"
variation 2446
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:940981222"
variation 2447
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:545263534"
variation 2450
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1243224119"
variation 2451
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:974755450"
variation 2456
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1832893489"
variation 2459
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1187806998"
variation 2461
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1463505286"
variation 2464
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1027226205"
variation 2466
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:896840674"
variation 2467
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:970664780"
variation 2472
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1429528794"
variation 2473
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1205541095"
variation 2474
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:372769805"
variation 2475
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832893806"
variation 2476
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1014397273"
variation 2478
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1248457863"
variation 2486
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:980292260"
variation 2489
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1360211872"
variation 2490
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1296998768"
variation 2491
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1832894033"
variation 2492
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:928751209"
variation 2493
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832894110"
variation 2495
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1832894155"
variation 2498
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1170898118"
variation 2499
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1588569998"
variation 2511
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1832894277"
variation 2516
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1045497866"
variation 2518
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1319388289"
variation 2520
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1424265910"
variation 2522
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1303923113"
variation 2525
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1832894389"
variation 2526
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832894428"
variation 2527
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832894465"
variation 2529
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832894503"
variation 2530
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:905656447"
variation 2532
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832894581"
variation 2536
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1832894622"
variation 2543
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1832894663"
variation 2546
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832894695"
variation 2547
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="t"
/db_xref="dbSNP:1001372129"
variation 2555
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832894767"
variation 2561
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1161210319"
variation 2563
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1351746571"
variation 2565
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:938759296"
variation 2566
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:988867282"
variation 2567
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1385257262"
variation 2569
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832895028"
variation 2577
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832895060"
variation 2578
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="t"
/replace="tt"
/db_xref="dbSNP:1832895090"
variation 2579
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:565031120"
variation 2580
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832895174"
variation 2582
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:527585577"
variation 2584
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:879880881"
variation 2585
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1588570043"
variation 2586
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1243837730"
variation 2592..2600
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="tcctcc"
/replace="tcctcctcc"
/db_xref="dbSNP:1291188600"
variation 2593
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1450762192"
variation 2596
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832895458"
variation 2597..2599
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="ctc"
/db_xref="dbSNP:1265043941"
variation 2599
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:540938027"
variation 2603..2605
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="gg"
/replace="ggg"
/db_xref="dbSNP:1832895684"
variation 2604
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832895722"
variation 2607
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1043393811"
variation 2608
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:2131276921"
variation 2609
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1229005880"
variation 2612
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:2131276936"
variation 2615
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1588570072"
variation 2616
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832895875"
variation 2621
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1226363048"
variation 2622
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:900408074"
variation 2623
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:931846153"
variation 2624
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1051547352"
variation 2625
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1564405506"
variation 2631
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1342069220"
variation 2641
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1020681708"
variation 2644
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:890253093"
variation 2645
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1329670143"
variation 2646
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832896248"
variation 2649
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1305362285"
variation 2650
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832896336"
variation 2653
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832896367"
variation 2654..2658
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="tgt"
/replace="tgtgt"
/db_xref="dbSNP:1244869063"
variation 2655
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:764982484"
variation 2662
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1014608992"
variation 2665
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832896536"
variation 2666
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832902904"
variation 2670
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:966085819"
variation 2671
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:976539099"
variation 2676
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:141987207"
variation 2678
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1421039220"
variation 2679
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832903179"
variation 2680
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:994507146"
variation 2681
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832903249"
variation 2682
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832903286"
variation 2686
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832903322"
variation 2689
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1168356204"
variation 2691
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:541462309"
variation 2698
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832903426"
variation 2699
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1832903454"
variation 2701
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:376779045"
variation 2704
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832903522"
variation 2706
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:2131277070"
variation 2709..2713
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="gggg"
/replace="ggggg"
/db_xref="dbSNP:1375701813"
variation 2716
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832903602"
variation 2718
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832903634"
variation 2719
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:970340057"
variation 2721
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:980728644"
variation 2725
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1035876656"
variation 2727..2729
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:34327627"
variation 2730..2733
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="ct"
/replace="ctct"
/db_xref="dbSNP:984918530"
variation 2737
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1251439477"
variation 2738
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:960173854"
variation 2742..2748
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="tcct"
/replace="tcctcct"
/db_xref="dbSNP:1203300097"
variation 2742
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1832904065"
variation 2747
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1439569651"
variation 2751
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1190987018"
variation 2752
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:909416276"
variation 2754
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:764194341"
variation 2768
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1285547160"
variation 2774
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832904320"
variation 2783
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1224576536"
variation 2787
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:529302877"
variation 2789
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:7048106"
variation 2790
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1439572089"
variation 2793
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:972359257"
variation 2794
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832904733"
variation 2798
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832904771"
variation 2799
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1329007619"
variation 2800
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1444384505"
variation 2802
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1403909364"
variation 2803
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1164522927"
variation 2810
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:913304286"
variation 2811
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:947407962"
variation 2812
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832905062"
variation 2817
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:917784392"
variation 2818
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832905103"
variation 2821
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:978780881"
variation 2822
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:2131277199"
variation 2823
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1480608012"
variation 2824
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:55957311"
variation 2825
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1158516617"
variation 2827
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:931924253"
variation 2828
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1832905309"
variation 2829
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:949095544"
variation 2830
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:2131277225"
variation 2833
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1233501637"
variation 2837
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1045852431"
variation 2839
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:905607937"
variation 2841
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1051602453"
variation 2845
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1042198332"
variation 2848
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:146292791"
variation 2849
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:940516256"
variation 2851
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:781329230"
variation 2854
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832905669"
variation 2855
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:898914011"
variation 2856
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832905717"
variation 2857
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="t"
/db_xref="dbSNP:1832905741"
variation 2861
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1368144030"
variation 2865
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1832905801"
variation 2866
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832905824"
variation 2867
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1832905853"
variation 2871
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:994957099"
variation 2874
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1564405607"
variation 2876
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1380398485"
variation 2878
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832905988"
variation 2880
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1451610897"
variation 2882
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1044745268"
variation 2883..2902
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="gtgtagcaggtaagatgccg"
/db_xref="dbSNP:1832906050"
variation 2887
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:904828888"
variation 2889
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832906131"
variation 2890
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:371890044"
variation 2891..2892
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="gg"
/db_xref="dbSNP:1832906236"
variation 2891
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1156726635"
variation 2895
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1035927520"
variation 2897
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:138491306"
variation 2901
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1020209219"
variation 2902
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:901802104"
variation 2906
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832906399"
variation 2907
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:960221254"
variation 2911
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832906464"
variation 2912
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:764310595"
variation 2913
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832906530"
variation 2917
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1245046619"
variation 2918
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:571463265"
variation 2920
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1010400477"
variation 2925
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1220652868"
variation 2933
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1020417937"
variation 2934
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:968833399"
variation 2937
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1588570282"
variation 2938
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832906784"
variation 2939
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:997527179"
variation 2941
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace=""
/replace="g"
/db_xref="dbSNP:376365688"
variation 2941
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832906850"
variation 2944
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:1832906911"
variation 2945
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="g"
/db_xref="dbSNP:1284449726"
variation 2947
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:953452221"
variation 2950
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1832906986"
variation 2955
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1356594758"
variation 2956..2975
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="tggcaaggtgtttaacagtg"
/replace="tggcaaggtgtttaacagtggcaaggtgtttaacagtg"
/db_xref="dbSNP:1832907081"
variation 2956
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1832907051"
variation 2957
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832907111"
variation 2958
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1316565534"
variation 2963
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:979219033"
variation 2965
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:750655743"
variation 2970
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1364422079"
variation 2971
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:756593973"
variation 2973
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:534530929"
variation 2975
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1832907318"
variation 2989
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="c"
/db_xref="dbSNP:2131277461"
variation 2990
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1432705252"
variation 2992
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="a"
/replace="g"
/db_xref="dbSNP:921968996"
variation 2995
/gene="SLC27A4"
/gene_synonym="ACSVL4; FATP4; IPS"
/replace="c"
/replace="t"
/db_xref="dbSNP:1468803306"
ORIGIN
cactgccttccaaagaaacgattgaacaggagaagcaagcaagcgaatcgtaatgaggcgtgcaccgccaatatgcattgccacaatgctgcttggagcctctctggtgggggtgctgctgttctccaagctggtgctgaaactgccctggacccaggtgggattctccctgttgttcctctacttgggatctggcggctggcgcttcatccgggtcttcatcaagaccatcaggcgcgatatctttggcggcctggtcctcctgaaggtgaaggcaaaggtgcgacagtgcctgcaggagcggcggacagtgcccattttgtttgcctctaccgttcggcgccaccccgacaagacggccctgatcttcgagggcacagatacccactggaccttccgccagctggatgagtactcaagcagtgtagccaacttcctgcaggcccggggcctggcctcgggcgatgtggctgccatcttcatggagaaccgcaatgagttcgtgggcctatggctgggcatggccaagctcggtgtggaggcagccctcatcaacaccaacctgcggcgggatgctctgctccactgcctcaccacctcgcgcgcacgggcccttgtctttggcagcgaaatggcctcagccatctgtgaggtccatgccagcctggacccctcgctcagcctcttctgctctggctcctgggagcccggtgcggtgcctccaagcacagaacacctggaccctctgctgaaagatgctcccaagcaccttcccagttgccctgacaagggcttcacagataaactgttctacatctacacatccggcaccacagggctgcccaaggccgccatcgtggtgcacagcaggtattaccgcatggctgccctggtgtactatggattccgcatgcggcccaacgacatcgtctatgactgcctccccctctaccactcagcaggaaacatcgtgggaatcggccagtgcctgctgcatggcatgacggtggtgattcggaagaagttctcagcctcccggttctgggacgattgtatcaagtacaactgcacgattgtgcagtacattggtgaactgtgccgctacctcctgaaccagccaccgcgggaggcagaaaaccagcaccaggttcgcatggcactaggcaatggcctccggcagtccatctggaccaacttttccagccgcttccacataccccaggtggctgagttctacggggccacagagtgcaactgtagcctgggcaacttcgacagccaggtgggggcctgtggtttcaatagccgcatcctgtccttcgtgtaccccatccggttggtacgtgtcaacgaggacaccatggagctgatccgggggcccgacggcgtctgcattccctgccagccaggtgagccgggccagctggtgggccgcatcatccagaaagaccccctgcgccgcttcgatggctacctcaaccagggcgccaacaacaagaagattgccaaggatgtcttcaagaagggggaccaggcctaccttactggtgatgtgctggtgatggacgagctgggctacctgtacttccgagaccgcactggggacacgttccgctggaaaggtgagaacgtgtccaccaccgaggtggaaggcacactcagccgcctgctggacatggctgacgtggccgtgtatggtgtcgaggtgccaggaaccgagggccgggccggaatggctgctgtggccagccccactggcaactgtgacctggagcgctttgctcaggtcttggagaaggaactgcccctgtatgcgcgccccatcttcctgcgcctcctgcctgagctgcacaaaacaggaacctacaagttccagaagacagagctacggaaggagggctttgacccggctattgtgaaagacccgctgttctatctagatgcccagaagggccgctacgtcccgctggaccaagaggcctacagccgcatccaggcaggcgaggagaagctgtgattccccccatccctctgagggccggcggatgctggatccggagccccaggttccgccccagagcggtcctggacaaggccagaccaaagcaagcagggcctggcacctccatcctgaggtgctgcccctccatccaaaactgccaagtgactcattgccttcccaacccttccagaggctttctgtgaaagtctcatgtccaagttccgtcttctgggctgggcaggccctctggttcccaggctgagactgacgggttttctcaggatgatgtcttgggtgagggtagggagaggacaaggggtcaccgagcccttcccagagagcagggagcttataaatggaaccagagcagaagtccccagactcaggaagtcaacagagtgggcagggacagtggtagcatccatctggtggccaaagagaatcgtagccccagagctgcccaagttcactgggctccacccccacctccaggaggggaggagaggacctgacatctgtaggtggcccctgatgccccatctacagcaggaggtcaggaccacgcccctggcctctccccactcccccatcctcctccctgggtggctgcctgattatccctcaggcagggcctctcagtccttgtgggtctgtgtcacctccatctcagtcttggcctggctatgaggggaggaggaatgggagagggggctcaggggccaataaactctgccttgagtcctcctagcctgtgtgcaaaccacccaagcccaccctgaccccagaaccccacagccccactgtggccgcttgatcccccacgccaaccccctggcccattgacccgcctcatctgttcattcacttatctaagctgagggtgtagcaggtaagatgccgcagcccctgcctccaatgtgctggttcagccgggggcagtgcccatgtgaatctggcaaggtgtttaacagtgtgggcttgaaagtccaaacca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]