LOCUS       XM_017030144            1590 bp    mRNA    linear   PRI 05-OCT-2023
DEFINITION  PREDICTED: Homo sapiens inactive glutathione hydrolase 2
            (LOC102724197), transcript variant X9, mRNA.
ACCESSION   XM_017030144
VERSION     XM_017030144.2
DBLINK      BioProject: PRJNA168
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NT_187386.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Apr 5, 2022 this sequence version replaced XM_017030144.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_000001405.40-RS_2023_10
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           RefSeqFE; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 10/02/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1590
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="22"
                     /map="unlocalized"
     gene            1..1590
                     /gene="LOC102724197"
                     /note="inactive glutathione hydrolase 2; Derived by
                     automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 3 Proteins, and 95% coverage of the annotated genomic
                     feature by RNAseq alignments, including 2 samples with
                     support for all annotated introns"
                     /db_xref="GeneID:102724197"
     CDS             108..1427
                     /gene="LOC102724197"
                     /codon_start=1
                     /product="putative glutathione hydrolase light chain 3
                     isoform X3"
                     /protein_id="XP_016885633.1"
                     /db_xref="GeneID:102724197"
                     /translation="

MPARWPPGWPLPACSTARSSPRREGCRWRCLGRSEAMSWHTSGMGGCPGLASSSPASSWPARASPWARAWRQSWKTSGPSSSSSLSCGGIVTAEDLNNYCAELIEHPLNISLGDAVLYMPSARLSGPVLALILNILKGYNFSRESVETPEQKGLTYYRIVEAFRFAYAKRTLLGDPKFVDVTEVVRNMTSEFFTAQLRSQISDHTTHPISYYKPEFYTPDDGGTAHLSVVAEDGSAVSATSTINLYFGSKVCSPVSGILFNNEWTTSALPAFTNEFGAPPSPANFIQPGKQPLLSMCPTIMVGQDGQVRMVVGAAGGTQITTDTALVCVTPFLPGPAHSAQPPSHADHTPMPQAIIYNLWFGYDVKRAVEEPRLHNKLLPNVTTVERNIDQAVTAALETRHHHTQIASTFIAVVQAIVRTAGGWAAASDSRKGGEPAGY"

     misc_feature    <375..1409
                     /gene="LOC102724197"
                     /note="Gamma-glutamyltranspeptidase; Region:
                     G_glu_transpept; cl19223"
                     /db_xref="CDD:450276"
     variation       116
                     /gene="LOC102724197"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2087113433"
     variation       140
                     /gene="LOC102724197"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2087113509"
     variation       193
                     /gene="LOC102724197"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2087119285"
     variation       212
                     /gene="LOC102724197"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2087119369"
     variation       250
                     /gene="LOC102724197"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2087119435"
     variation       343
                     /gene="LOC102724197"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1556066253"
     variation       344
                     /gene="LOC102724197"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2087119620"
     variation       576
                     /gene="LOC102724197"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2087122402"
     variation       609
                     /gene="LOC102724197"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2087122496"
     variation       687
                     /gene="LOC102724197"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1556066369"
     polyA_site      1590
                     /gene="LOC102724197"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      

gggttgggccgaggcacagctgggtggcccccaggctcacgtggcataaagggttttggtgggtgggcctgcctacctgcttcttctaggaaaagctgaggtcatcaatgcccgcgaggtggcccccaggctggcctttgccagcatgttcaacagctcggagcagtcccagaagggagggctgtcggtggcggtgcctggggagatccgaggctatgagctggcacaccagcggcatgggcggctgccctgggctcgcctcttccagcccagcatccagctggcccgccagggcttccccgtgggcaagggcttggcggcagtcctggaaaacaagcggaccgtcatcgagcagcagcctgtcttgtgggggcattgtgacagctgaggacctgaacaactactgtgctgagctgatcgagcacccgctgaacatcagcctgggagacgcggtgctgtacatgcccagtgcgcggctcagcgggcccgtgctggccctcatcctcaacatcctcaaagggtacaacttctcccgggagagcgtggagacccccgagcagaagggcctgacgtactaccgcatcgtagaggctttccggtttgcctacgccaagaggaccctgcttggggaccccaagtttgtggatgtgactgaggtggtccgcaacatgacctctgagttcttcactgcccagctccggtcccagatctctgaccacaccactcacccgatctcctactacaagcccgagttctacacgccggatgacgggggcactgctcacctgtctgtcgtcgcagaggacggcagtgctgtgtccgccaccagcaccatcaacctctactttggctccaaggtctgctccccggtcagtgggatcctgttcaataatgaatggacgacttcagctctcccagcattcaccaatgagtttggggcacccccctcacctgccaatttcatccagccagggaagcagccgctcttgtccatgtgcccgacgatcatggtgggccaggacggccaggtccggatggtggtgggagctgctgggggcacgcagatcaccacagacactgcactggtatgtgtcaccccttttctccctggccctgcccactctgcacagcccccaagccacgctgatcacactcccatgccccaggccatcatctacaacctctggttcggctatgacgtgaagagggccgtggaggagccccggctgcacaacaagcttctgcccaacgtcacgacagtggagagaaacattgaccaggcagtgactgcagccctggagacccggcaccatcacacccagatcgcgtccaccttcatcgctgtggtgcaagccatcgtccgcacggctggtggctgggcagctgcctcggactccaggaaaggcggggaacctgctggctactgagtgctccaggcagacaaggctgacaagcaatccagggacaagatactcaccaggatgaggaagaggactttgggggacgggcttcccctgtgagcagcagagcagcataataaatgaggccactgtgccaggctccaggtggcctccctggcctgtctcccca

//