GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-06-25 06:19:57, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NR_187757                737 bp    RNA     linear   PRI 06-SEP-2023
DEFINITION  Homo sapiens uncharacterized LOC102724087 (LOC102724087),
            transcript variant 3, long non-coding RNA.
ACCESSION   NR_187757 XR_007059856 XR_007077283
VERSION     NR_187757.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AL391361.18 and AL139393.13.
            
            On or before Sep 6, 2023 this sequence version replaced
            XR_007059856.1, XR_007077283.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR5189667.5943.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA1968968, SAMEA2151119
                                           [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-94                AL391361.18        92259-92352
            95-221              AL391361.18        93327-93453
            222-375             AL391361.18        94084-94237
            376-471             AL139393.13        26128-26223
            472-578             AL139393.13        36877-36983
            579-737             AL139393.13        48214-48372
FEATURES             Location/Qualifiers
     source          1..737
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="6"
                     /map="6q26"
     gene            1..737
                     /gene="LOC102724087"
                     /note="uncharacterized LOC102724087"
                     /db_xref="GeneID:102724087"
     ncRNA           1..737
                     /ncRNA_class="lncRNA"
                     /gene="LOC102724087"
                     /product="uncharacterized LOC102724087, transcript variant
                     3"
                     /db_xref="GeneID:102724087"
     exon            1..94
                     /gene="LOC102724087"
                     /inference="alignment:Splign:2.1.0"
     exon            95..221
                     /gene="LOC102724087"
                     /inference="alignment:Splign:2.1.0"
     exon            222..375
                     /gene="LOC102724087"
                     /inference="alignment:Splign:2.1.0"
     exon            376..471
                     /gene="LOC102724087"
                     /inference="alignment:Splign:2.1.0"
     exon            472..578
                     /gene="LOC102724087"
                     /inference="alignment:Splign:2.1.0"
     exon            579..737
                     /gene="LOC102724087"
                     /inference="alignment:Splign:2.1.0"
     regulatory      712..717
                     /regulatory_class="polyA_signal_sequence"
                     /gene="LOC102724087"
                     /note="hexamer: AATAAA"
     polyA_site      737
                     /gene="LOC102724087"
                     /note="major polyA site"
ORIGIN      
agaaggagctggaggccccgggagtgcagacggcatttcagtgctcacaggagagcgtccgtagatggcgaggacagagaaggggttaccagggcttccaaaaccgcgagaaataaatgtctgtgtctaaaccccaaccctaccacctcaactgccgtgtgtggtgttttgtgatggcagccccagctgactgagacacctggttagaccggaataagcaggctgcaatcggtagcagtcaccattgaacatccttgaagcaattcttccaaaattaccttgcatcaaagactgcacaagaactgctctaagcggaaggactgatgtcggcaaccagggttccaccaggggctgcagacagcccttgaccttcagaagtaaccaaatttactcacgtaggccaggaatttctatgacgtgttccaaattcagcctctcactgaacacttccagagcaaggcaacataaacatctgcaagaagaacattgtgtgagaaatatcaagtgagagtggaagagtctgcggagggcctccctggggctcacctgtgcttttgcctgagcttcaccgtgtcaaggatgcagcactttttccctctggaggaagcagctttcaccttggaagaatcttgaccttgccattcaaagtcaccagacagggaatctgccagtgccttgatcttagacttcccagcttctgtaactgtgagcaataaatgtatgctgcttataaacta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]