LOCUS       NR_176338               2977 bp    RNA     linear   PRI 23-JAN-2023
DEFINITION  Homo sapiens tropomyosin 1 (TPM1), transcript variant 43,
            non-coding RNA.
ACCESSION   NR_176338
VERSION     NR_176338.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2977)
  AUTHORS   Nefedova VV, Kopylova GV, Shchepkin DV, Kochurova AM, Kechko OI,
            Borzova VA, Ryabkova NS, Katrukha IA, Mitkevich VA, Bershitsky SY,
            Levitsky DI and Matyushenko AM.
  TITLE     Impact of Troponin in Cardiomyopathy Development Caused by
            Mutations in Tropomyosin
  JOURNAL   Int J Mol Sci 23 (24), 15723 (2022)
   PUBMED   36555368
  REMARK    GeneRIF: Impact of Troponin in Cardiomyopathy Development Caused by
            Mutations in Tropomyosin.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 2977)
  AUTHORS   Li C, Hong S, Hu H, Liu T, Yan G and Sun D.
  TITLE     MYC-Induced Upregulation of Lncrna ELFN1-AS1 Contributes to Tumor
            Growth in Colorectal Cancer via Epigenetically Silencing TPM1
  JOURNAL   Mol Cancer Res 20 (11), 1697-1708 (2022)
   PUBMED   35857351
  REMARK    GeneRIF: MYC-Induced Upregulation of Lncrna ELFN1-AS1 Contributes
            to Tumor Growth in Colorectal Cancer via Epigenetically Silencing
            TPM1.
REFERENCE   3  (bases 1 to 2977)
  AUTHORS   Teekakirikul P, Zhu W, Xu X, Young CB, Tan T, Smith AM, Wang C,
            Peterson KA, Gabriel GC, Ho S, Sheng Y, Moreau de Bellaing A,
            Sonnenberg DA, Lin JH, Fotiou E, Tenin G, Wang MX, Wu YL, Feinstein
            T, Devine W, Gou H, Bais AS, Glennon BJ, Zahid M, Wong TC, Ahmad F,
            Rynkiewicz MJ, Lehman WJ, Keavney B, Alastalo TP, Freckmann ML,
            Orwig K, Murray S, Ware SM, Zhao H, Feingold B and Lo CW.
  TITLE     Genetic resiliency associated with dominant lethal TPM1 mutation
            causing atrial septal defect with high heritability
  JOURNAL   Cell Rep Med 3 (2), 100501 (2022)
   PUBMED   35243414
  REMARK    GeneRIF: Genetic resiliency associated with dominant lethal TPM1
            mutation causing atrial septal defect with high heritability.
            Publication Status: Online-Only
REFERENCE   4  (bases 1 to 2977)
  AUTHORS   Man Y, Yi C, Fan M, Yang T, Liu P, Liu S and Wang G.
  TITLE     Identification of a novel missense mutation in the TPM1 gene via
            exome sequencing in a Chinese family with dilated cardiomyopathy: A
            case report and literature review
  JOURNAL   Medicine (Baltimore) 101 (2), e28551 (2022)
   PUBMED   35029218
  REMARK    GeneRIF: Identification of a novel missense mutation in the TPM1
            gene via exome sequencing in a Chinese family with dilated
            cardiomyopathy: A case report and literature review.
            Review article
REFERENCE   5  (bases 1 to 2977)
  AUTHORS   Geeves MA, Hitchcock-DeGregori SE and Gunning PW.
  TITLE     A systematic nomenclature for mammalian tropomyosin isoforms
  JOURNAL   J Muscle Res Cell Motil 36 (2), 147-153 (2015)
   PUBMED   25369766
  REMARK    Review article
REFERENCE   6  (bases 1 to 2977)
  AUTHORS   Cirino,A.L. and Ho,C.
  TITLE     Hypertrophic Cardiomyopathy Overview
  JOURNAL   (in) Adam MP, Everman DB, Mirzaa GM, Pagon RA, Wallace SE, Bean
            LJH, Gripp KW and Amemiya A (Eds.);
            GENEREVIEWS(R);
            (1993)
   PUBMED   20301725
REFERENCE   7  (bases 1 to 2977)
  AUTHORS   Hershberger,R.E. and Jordan,E.
  TITLE     Dilated Cardiomyopathy Overview
  JOURNAL   (in) Adam MP, Everman DB, Mirzaa GM, Pagon RA, Wallace SE, Bean
            LJH, Gripp KW and Amemiya A (Eds.);
            GENEREVIEWS(R);
            (1993)
   PUBMED   20301486
REFERENCE   8  (bases 1 to 2977)
  AUTHORS   Chevray PM and Nathans D.
  TITLE     Protein interaction cloning in yeast: identification of mammalian
            proteins that react with the leucine zipper of Jun
  JOURNAL   Proc Natl Acad Sci U S A 89 (13), 5789-5793 (1992)
   PUBMED   1631061
REFERENCE   9  (bases 1 to 2977)
  AUTHORS   Lees-Miller JP and Helfman DM.
  TITLE     The molecular basis for tropomyosin isoform diversity
  JOURNAL   Bioessays 13 (9), 429-437 (1991)
   PUBMED   1796905
  REMARK    Review article
REFERENCE   10 (bases 1 to 2977)
  AUTHORS   Mak,A., Smillie,L.B. and Barany,M.
  TITLE     Specific phosphorylation at serine-283 of alpha tropomyosin from
            frog skeletal and rabbit skeletal and cardiac muscle
  JOURNAL   Proc Natl Acad Sci U S A 75 (8), 3588-3592 (1978)
   PUBMED   278975
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AC079328.11.
            
            Summary: This gene is a member of the tropomyosin family of highly
            conserved, widely distributed actin-binding proteins involved in
            the contractile system of striated and smooth muscles and the
            cytoskeleton of non-muscle cells. Tropomyosin is composed of two
            alpha-helical chains arranged as a coiled-coil. It is polymerized
            end to end along the two grooves of actin filaments and provides
            stability to the filaments. The encoded protein is one type of
            alpha helical chain that forms the predominant tropomyosin of
            striated muscle, where it also functions in association with the
            troponin complex to regulate the calcium-dependent interaction of
            actin and myosin during muscle contraction. In smooth muscle and
            non-muscle cells, alternatively spliced transcript variants
            encoding a range of isoforms have been described. Mutations in this
            gene are associated with type 3 familial hypertrophic
            cardiomyopathy and dilated cardiomyopathy 1Y. [provided by RefSeq,
            Jun 2022].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR1803617.163609.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA1968540, SAMEA1968968
                                           [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-197               AC079328.11        135266-135462
            198-323             AC079328.11        136546-136671
            324-457             AC079328.11        149504-149637
            458-575             AC079328.11        152082-152199
            576-646             AC079328.11        153388-153458
            647-722             AC079328.11        153717-153792
            723-798             AC079328.11        154232-154307
            799-861             AC079328.11        154734-154796
            862-931             AC079328.11        155095-155164
            932-2977            AC079328.11        162389-164434
FEATURES             Location/Qualifiers
     source          1..2977
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="15"
                     /map="15q22.2"
     gene            1..2977
                     /gene="TPM1"
                     /gene_synonym="C15orf13; CMD1Y; CMH3; HEL-S-265;
                     HTM-alpha; LVNC9; TMSA"
                     /note="tropomyosin 1"
                     /db_xref="GeneID:7168"
                     /db_xref="HGNC:HGNC:12010"
                     /db_xref="MIM:191010"
     misc_RNA        1..2977
                     /gene="TPM1"
                     /gene_synonym="C15orf13; CMD1Y; CMH3; HEL-S-265;
                     HTM-alpha; LVNC9; TMSA"
                     /product="tropomyosin 1, transcript variant 43"
                     /db_xref="GeneID:7168"
                     /db_xref="HGNC:HGNC:12010"
                     /db_xref="MIM:191010"
     exon            1..197
                     /gene="TPM1"
                     /gene_synonym="C15orf13; CMD1Y; CMH3; HEL-S-265;
                     HTM-alpha; LVNC9; TMSA"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    84..740
                     /gene="TPM1"
                     /gene_synonym="C15orf13; CMD1Y; CMH3; HEL-S-265;
                     HTM-alpha; LVNC9; TMSA"
                     /inference="COORDINATES:
                     alignment:Blast2seq::RefSeq|NM_001407337.1"
                     /note="primary ORF has stop codon >50 nucleotides from the
                     terminal splice site; nonsense-mediated decay (NMD)
                     candidate"
     exon            198..323
                     /gene="TPM1"
                     /gene_synonym="C15orf13; CMD1Y; CMH3; HEL-S-265;
                     HTM-alpha; LVNC9; TMSA"
                     /inference="alignment:Splign:2.1.0"
     exon            324..457
                     /gene="TPM1"
                     /gene_synonym="C15orf13; CMD1Y; CMH3; HEL-S-265;
                     HTM-alpha; LVNC9; TMSA"
                     /inference="alignment:Splign:2.1.0"
     exon            458..575
                     /gene="TPM1"
                     /gene_synonym="C15orf13; CMD1Y; CMH3; HEL-S-265;
                     HTM-alpha; LVNC9; TMSA"
                     /inference="alignment:Splign:2.1.0"
     exon            576..646
                     /gene="TPM1"
                     /gene_synonym="C15orf13; CMD1Y; CMH3; HEL-S-265;
                     HTM-alpha; LVNC9; TMSA"
                     /inference="alignment:Splign:2.1.0"
     exon            647..722
                     /gene="TPM1"
                     /gene_synonym="C15orf13; CMD1Y; CMH3; HEL-S-265;
                     HTM-alpha; LVNC9; TMSA"
                     /inference="alignment:Splign:2.1.0"
     exon            723..798
                     /gene="TPM1"
                     /gene_synonym="C15orf13; CMD1Y; CMH3; HEL-S-265;
                     HTM-alpha; LVNC9; TMSA"
                     /inference="alignment:Splign:2.1.0"
     exon            799..861
                     /gene="TPM1"
                     /gene_synonym="C15orf13; CMD1Y; CMH3; HEL-S-265;
                     HTM-alpha; LVNC9; TMSA"
                     /inference="alignment:Splign:2.1.0"
     exon            862..931
                     /gene="TPM1"
                     /gene_synonym="C15orf13; CMD1Y; CMH3; HEL-S-265;
                     HTM-alpha; LVNC9; TMSA"
                     /inference="alignment:Splign:2.1.0"
     exon            932..2977
                     /gene="TPM1"
                     /gene_synonym="C15orf13; CMD1Y; CMH3; HEL-S-265;
                     HTM-alpha; LVNC9; TMSA"
                     /inference="alignment:Splign:2.1.0"
     regulatory      2946..2951
                     /regulatory_class="polyA_signal_sequence"
                     /gene="TPM1"
                     /gene_synonym="C15orf13; CMD1Y; CMH3; HEL-S-265;
                     HTM-alpha; LVNC9; TMSA"
                     /note="hexamer: AATAAA"
     polyA_site      2977
                     /gene="TPM1"
                     /gene_synonym="C15orf13; CMD1Y; CMH3; HEL-S-265;
                     HTM-alpha; LVNC9; TMSA"
                     /note="major polyA site"
ORIGIN      

gctcgcactcccgctcctccgcccgaccgcgcgctcgccccgccgctcctgctgcagccccagggcccctcgccgccgccaccatggacgccatcaagaagaagatgcagatgctgaagctcgacaaggagaacgccttggatcgagctgagcaggcggaggccgacaagaaggcggcggaagacaggagcaagcagctggaagatgagctggtgtcactgcaaaagaaactcaagggcaccgaagatgaactggacaaatactctgaggctctcaaagatgcccaggagaagctggagctggcagagaaaaaggccaccgatgctgaagccgacgtagcttctctgaacagacgcatccagctggttgaggaagagttggatcgtgcccaggagcgtctggcaacagctttgcagaagctggaggaagctgagaaggcagcagatgagagtgagagaggcatgaaagtcattgagagtcgagcccaaaaagatgaagaaaaaatggaaattcaggagatccaactgaaagaggccaagcacattgctgaagatgccgaccgcaaatatgaagaggtggcccgtaagctggtcatcattgagagcgacctggaacgtgcagaggagcgggctgagctctcagaaggccaagtccgacagctggaagaacaattaagaataatggatcagaccttgaaagcattaatggctgcagaggataagcaaatgtgccgagcttgaagaagaattgaaaactgtgacgaacaacttgaagtcactggaggctcaggctgagaagtactcgcagaaggaagacagatatgaggaagagatcaaggtcctttccgacaagctgaaggaggctgagactcgggctgagtttgcggagaggtcagtaactaaattggagaaaagcattgatgacttagaagatcaactctaccagcaacttgagcaaaatcgccgcctcactaatgaactaaagctggccctgaatgaggattaaacttaagagtgaaaaaacttgggctgaattctaggcgtggagcccatgtgcagaaaatctaagactgtcctaccttcaactaatagagttgaaaacagttgctttctgcagaaatgcaaatgcaaggaattggctgaaaggctggccttgcctgcttgtttctctatatggctggaataattacgttctctttaatcacaaaacagcttttatggtagaatacttatatcaattcagcactgctccttgaaatagcaggtcctcttgtttgaactgataaataatgaggagcccccccaaaaaatgttttctatttcctgacagccatgagtcctactttaagtatgtatatatatatatatatgtgtgtgtgtgtgtgtgtgtatatattcctatcagatactcatattcctaacttctaaatatctggtatagtgtttgaaatatgattaaatgtacctatgcttgggcaaaatagcttttgaaaacaggaactcatgccagaagcccctggttgtctgaaaggtatgctttactcagtctaatggtgctgttggagtctggggagaatgtcatgctaataaatagaacactataaaaatattaagagaatgtcctaatgaagtgtgcatgaaacatgttgacaattttttatgagcaacagaaataaatcattttaaaagttctcagaaaacctatttatgtcatctttgcttttgtgagtttgtgttaccgcacaactcccagacttttaactgcctgtaccttggaaatgtctgctgttcgtaacttcttcagtttgtataacagtgctgcagctgtatttggtttttacctctccctgttcccacggcacaccgtcagtgaaccttcaccaaaccccacgtgcattttatcctcagtgaattgttggtggaggtgcacctgactgctctgtgagaatccgtgccatggctcctttgggtcaaagatgccctcccctccgtcttaggttcttgtctagaaatgagtaatgtcttacaagcatgcctagttctaatcatctcatcctgtgtttgtgattgatgtttgcctgcctaaatgtacaaaccaccattgtgtccaaagcacagctattcatgacttaattttctaatctcaccacagagaaagtggctcatgccaaagaagaaaaccttagtatgcatcagatgctggatcagactttactggagttaaacaacatgtgaaaacctccttagctgcgaccacattctttcgttttgttttgttttgtttttaaacacctgcttaccccttaaatgcaatttatttacttttaccactgtcacagaaacatccacaagataccagctaggtcagggggtggggaaaacacatacaaaaaggcaagcccatgtcagggcgatcctggttcaaatgtgccatttcccgggttgatgctgccacactttgtagagagtttagcaacacagtgtgcttagtcagcgtaggaatcctcactaaagcagaagaagttccattcaaagtgccaatgatagagtcaacaggaaggttaatgttggaaacacaatcaggtgtggattggtgctactttgaacaaaaggtccccctgtggtcttttgttcaacattgtacaatgtagaactctgtccaacactaatttattttgtcttgagttttactacaagatgagactatggatcccgcatgcctgaattcactaaagccaagggtctgtaagccacgctgctcttccgagacttccattcctttctgattggcacacgtgcagctcatgacaatctgtaggataacaatcagtgtggatttccactcttttcagtccttcatgttaaagatttagacaccacatacaactggtaaaggacgttttcttgagagttttaactatatgtaaacattgtataatgatatggaataaaatgcacattgtaggacattttctaaa

//