GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-06 17:45:26, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NR_172123               2067 bp    RNA     linear   PRI 18-JUL-2022
DEFINITION  Homo sapiens pregnancy specific beta-1-glycoprotein 7 (PSG7),
            transcript variant 1, non-coding, non-coding RNA.
ACCESSION   NR_172123
VERSION     NR_172123.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2067)
  AUTHORS   Kandel M, MacDonald TM, Walker SP, Cluver C, Bergman L, Myers J,
            Hastie R, Keenan E, Hannan NJ, Cannon P, Nguyen TV, Pritchard N,
            Tong S and Kaitu'u-Lino TJ.
  TITLE     PSG7 and 9 (Pregnancy-Specific beta-1 Glycoproteins 7 and 9): Novel
            Biomarkers for Preeclampsia
  JOURNAL   J Am Heart Assoc 11 (7), e024536 (2022)
   PUBMED   35322669
  REMARK    GeneRIF: PSG7 and 9 (Pregnancy-Specific beta-1 Glycoproteins 7 and
            9): Novel Biomarkers for Preeclampsia.
REFERENCE   2  (bases 1 to 2067)
  AUTHORS   Camolotto S, Racca A, Rena V, Nores R, Patrito LC, Genti-Raimondi S
            and Panzetta-Dutari GM.
  TITLE     Expression and transcriptional regulation of individual
            pregnancy-specific glycoprotein genes in differentiating
            trophoblast cells
  JOURNAL   Placenta 31 (4), 312-319 (2010)
   PUBMED   20116096
REFERENCE   3  (bases 1 to 2067)
  AUTHORS   van der Heul-Nieuwenhuijsen L, Dits N, Van Ijcken W, de Lange D and
            Jenster G.
  TITLE     The FOXF2 pathway in the human prostate stroma
  JOURNAL   Prostate 69 (14), 1538-1547 (2009)
   PUBMED   19562724
REFERENCE   4  (bases 1 to 2067)
  AUTHORS   Endoh M, Kobayashi Y, Yamakami Y, Yonekura R, Fujii M and Ayusawa
            D.
  TITLE     Coordinate expression of the human pregnancy-specific glycoprotein
            gene family during induced and replicative senescence
  JOURNAL   Biogerontology 10 (2), 213-221 (2009)
   PUBMED   18792801
REFERENCE   5  (bases 1 to 2067)
  AUTHORS   Beauchemin N, Draber P, Dveksler G, Gold P, Gray-Owen S, Grunert F,
            Hammarstrom S, Holmes KV, Karlsson A, Kuroki M, Lin SH, Lucka L,
            Najjar SM, Neumaier M, Obrink B, Shively JE, Skubitz KM, Stanners
            CP, Thomas P, Thompson JA, Virji M, von Kleist S, Wagener C, Watt S
            and Zimmermann W.
  TITLE     Redefined nomenclature for members of the carcinoembryonic antigen
            family
  JOURNAL   Exp Cell Res 252 (2), 243-249 (1999)
   PUBMED   11501563
REFERENCE   6  (bases 1 to 2067)
  AUTHORS   Teglund S, Zhou GQ and Hammarstrom S.
  TITLE     Characterization of cDNA encoding novel pregnancy-specific
            glycoprotein variants
  JOURNAL   Biochem Biophys Res Commun 211 (2), 656-664 (1995)
   PUBMED   7794280
REFERENCE   7  (bases 1 to 2067)
  AUTHORS   Khan WN, Teglund S, Bremer K and Hammarstrom S.
  TITLE     The pregnancy-specific glycoprotein family of the immunoglobulin
            superfamily: identification of new members and estimation of family
            size
  JOURNAL   Genomics 12 (4), 780-787 (1992)
   PUBMED   1572651
REFERENCE   8  (bases 1 to 2067)
  AUTHORS   Leslie KK, Watanabe S, Lei KJ, Chou DY, Plouzek CA, Deng HC, Torres
            J and Chou JY.
  TITLE     Linkage of two human pregnancy-specific beta 1-glycoprotein genes:
            one is associated with hydatidiform mole
  JOURNAL   Proc Natl Acad Sci U S A 87 (15), 5822-5826 (1990)
   PUBMED   2377620
REFERENCE   9  (bases 1 to 2067)
  AUTHORS   Khan WN and Hammarstrom S.
  TITLE     Identification of a new carcinoembryonic antigen (CEA) family
            member in human fetal liver--cloning and sequence determination of
            pregnancy-specific glycoprotein 7
  JOURNAL   Biochem Biophys Res Commun 168 (1), 214-225 (1990)
   PUBMED   2328001
REFERENCE   10 (bases 1 to 2067)
  AUTHORS   Thompson J, Koumari R, Wagner K, Barnert S, Schleussner C, Schrewe
            H, Zimmermann W, Muller G, Schempp W, Zaninetta D et al.
  TITLE     The human pregnancy-specific glycoprotein genes are tightly linked
            on the long arm of chromosome 19 and are coordinately expressed
  JOURNAL   Biochem Biophys Res Commun 167 (2), 848-859 (1990)
   PUBMED   1690992
  REMARK    Erratum:[Biochem Biophys Res Commun 1990 May 16;168(3):1325]
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AC093055.3, BC030979.1 and
            AC005260.1.
            
            Summary: This gene is a member of the pregnancy-specific
            glycoprotein (PSG) gene family. The PSG genes are a subgroup of the
            carcinoembryonic antigen (CEA) family of immunoglobulin-like genes,
            and are found in a gene cluster at 19q13.1-q13.2 telomeric to
            another cluster of CEA-related genes. The PSG genes are expressed
            by placental trophoblasts and released into the maternal
            circulation during pregnancy, and are thought to be essential for
            maintenance of normal pregnancy. Alternative splicing results in
            multiple transcript variants. [provided by RefSeq, Feb 2014].
            
            Transcript Variant: This variant (1, non-coding) is represented as
            non-coding because the use of the 5'-most expected translational
            start codon renders the transcript a candidate for
            nonsense-mediated mRNA decay (NMD). This version of transcript
            variant 1 represents the non protein-coding major allele of this
            polymorphic locus with a mismatch compared to the reference genome
            sequence. A second version of transcript variant 1 represents the
            protein-coding minor allele.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: U18467.1, BC030979.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA2162568 [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-34                AC093055.3         3187-3220           c
            35-2059             BC030979.1         1-2025
            2060-2067           AC005260.1         29893-29900         c
FEATURES             Location/Qualifiers
     source          1..2067
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="19"
                     /map="19q13.31"
     gene            1..2067
                     /gene="PSG7"
                     /gene_synonym="PS-beta-G-7; PSBG-7; PSG1; PSGGA"
                     /note="pregnancy specific beta-1-glycoprotein 7"
                     /db_xref="GeneID:5676"
                     /db_xref="HGNC:HGNC:9524"
                     /db_xref="MIM:176396"
     misc_RNA        1..2067
                     /gene="PSG7"
                     /gene_synonym="PS-beta-G-7; PSBG-7; PSG1; PSGGA"
                     /product="pregnancy specific beta-1-glycoprotein 7,
                     transcript variant 1, non-coding"
                     /db_xref="GeneID:5676"
                     /db_xref="HGNC:HGNC:9524"
                     /db_xref="MIM:176396"
     exon            1..195
                     /gene="PSG7"
                     /gene_synonym="PS-beta-G-7; PSBG-7; PSG1; PSGGA"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    132..425
                     /gene="PSG7"
                     /gene_synonym="PS-beta-G-7; PSBG-7; PSG1; PSGGA"
                     /inference="COORDINATES:
                     alignment:Blast2seq::RefSeq|NM_002783.3"
                     /note="primary ORF has stop codon >50 nucleotides from the
                     terminal splice site; nonsense-mediated decay (NMD)
                     candidate"
     exon            196..561
                     /gene="PSG7"
                     /gene_synonym="PS-beta-G-7; PSBG-7; PSG1; PSGGA"
                     /inference="alignment:Splign:2.1.0"
     exon            562..840
                     /gene="PSG7"
                     /gene_synonym="PS-beta-G-7; PSBG-7; PSG1; PSGGA"
                     /inference="alignment:Splign:2.1.0"
     exon            841..1119
                     /gene="PSG7"
                     /gene_synonym="PS-beta-G-7; PSBG-7; PSG1; PSGGA"
                     /inference="alignment:Splign:2.1.0"
     exon            1120..1374
                     /gene="PSG7"
                     /gene_synonym="PS-beta-G-7; PSBG-7; PSG1; PSGGA"
                     /inference="alignment:Splign:2.1.0"
     exon            1375..2067
                     /gene="PSG7"
                     /gene_synonym="PS-beta-G-7; PSBG-7; PSG1; PSGGA"
                     /inference="alignment:Splign:2.1.0"
     regulatory      2042..2047
                     /regulatory_class="polyA_signal_sequence"
                     /gene="PSG7"
                     /gene_synonym="PS-beta-G-7; PSBG-7; PSG1; PSGGA"
                     /note="hexamer: AATAAA"
     polyA_site      2067
                     /gene="PSG7"
                     /gene_synonym="PS-beta-G-7; PSBG-7; PSG1; PSGGA"
                     /note="major polyA site"
ORIGIN      
agaagtgctcctgccccgggaagaggctcagtgcagaaggaggaaggacagcacagctgacagccgtgctcaggaagattctggatcctaggctcatctccacagaggagaacacgcagggagcagagaccatggggcccctctcagcccctccctgcacacagcatataacctggaaagggctcctgctcacagcatcacttttaaacttctggaacccgcccaccacagcccaagtcacgattgaagcccagccaccaaaagtttccgaggggaaggatgttcttctacttgtccacaatttgccccagaatcttactggctacatctggtacaaaggacaaatcagggacctctaccattatgttacatcatatatagtagacggtcaaataattaaatatgggcctgcatacagtggatgagaaacagtatattccaatgcatccctgctgatccagaatgtcacccaggaagacacaggatcctacactttacacatcataaagcgaggtgatgggactggaggagtaactggacgtttcaccttcaccttatacctggagactcccaaaccctccatctccagcagcaatttcaaccccagggaggccacggaggctgtgattttaacctgtgatcctgagactccagatgcaagctacctgtggtggatgaatggtcagagcctccctatgactcacagcttgcagctgtctgaaaccaacaggaccctctacctatttggtgtcacaaactatactgcaggaccctatgaatgtgaaatacggaacccagtgagtgccagccgcagtgacccagtcaccctgaatctcctcccgaagctgcccaagccctacatcaccatcaataacttaaaccccagggagaataaggatgtctcaaccttcacctgtgaacctaagagtgagaactacacctacatttggtggctaaatggtcagagcctcccggtcagtcccagggtaaagcgacgcattgaaaacaggatcctcattctacccagtgtcacgagaaatgaaacaggaccctatcaatgtgaaatacgggaccgatatggtggcatccgcagtgacccagtcaccctgaatgtcctctatggtccagacctccccagaatttacccttcattcacctattaccattcaggacaaaacctctacttgtcctgctttgcggactctaacccaccggcacagtattcttggacaattaatgggaagtttcagctatcaggacaaaagctttctatcccccagattactacaaagcatagcgggctctatgcttgctctgttcgtaactcagccactggcaaggaaagctccaaatccgtgacagtcagagtctctgactggacattaccctgaattctactagttcctccaattccatcttctcccatggaacctcaaagagcaagacccactctgttccagaagccctataagtcagagttggacaactcaatgtaaatttcatgggaaaatccttgtacctgatgtctgagccactcagaactcaccaaaatgttcaacaccataacaacagctgctcaaactgtaaacaaggaaaacaagttgatgacttcacactgtggacagcttttcccaagatgtcagaataagactccccatcatgatgaggctctcacccctcttagctgtccttgcttgtgcctgcctctttcacttggcaggataatgcagtcattagaatttcacatgtagtataggagcttctgagggtaacaacagagtgtcagatatgtcatctcaacctcagacttttacataacatctcaggaggaaatgtggctctctccatcttgcatacagggctcccaatagaaatgaacacagagatattgcctgtgtgtttgcagagaagatggtttctataaagagtaggaaagctgaaattatagtagactcccctttaaatgcacattgtgtggatggctctcaccatttcctaagagatacattgtaaaacgtgacagtaagactgattctagcagaataaaacatgtactacatttgctaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]