GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-09-30 11:13:54, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NR_049880                 85 bp    RNA     linear   PRI 03-SEP-2020
DEFINITION  Homo sapiens microRNA 5695 (MIR5695), microRNA.
ACCESSION   NR_049880
VERSION     NR_049880.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 85)
  AUTHORS   Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout
            PW and Wang Y.
  TITLE     MicroRNAs associated with metastatic prostate cancer
  JOURNAL   PLoS ONE 6 (9), e24950 (2011)
   PUBMED   21980368
REFERENCE   2  (bases 1 to 85)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res. 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AC092069.2.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-85                AC092069.2         69273-69357         c
FEATURES             Location/Qualifiers
     source          1..85
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="19"
                     /map="19p13.13"
     gene            1..85
                     /gene="MIR5695"
                     /note="microRNA 5695"
                     /db_xref="GeneID:100847016"
                     /db_xref="HGNC:HGNC:43548"
                     /db_xref="miRBase:MI0019302"
     precursor_RNA   1..85
                     /gene="MIR5695"
                     /product="microRNA 5695"
                     /db_xref="GeneID:100847016"
                     /db_xref="HGNC:HGNC:43548"
                     /db_xref="miRBase:MI0019302"
     exon            1..85
                     /gene="MIR5695"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="MIR5695"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1971234353"
     variation       2..3
                     /gene="MIR5695"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1971234376"
     variation       4
                     /gene="MIR5695"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1971234406"
     variation       7..17
                     /gene="MIR5695"
                     /replace="ctatcta"
                     /replace="ctatctatcta"
                     /db_xref="dbSNP:1208148129"
     variation       7
                     /gene="MIR5695"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1322847755"
     variation       8
                     /gene="MIR5695"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:974114649"
     variation       9
                     /gene="MIR5695"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1220965266"
     variation       10
                     /gene="MIR5695"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1316510126"
     variation       11
                     /gene="MIR5695"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1295330475"
     variation       12
                     /gene="MIR5695"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1599647440"
     variation       13
                     /gene="MIR5695"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1208352537"
     variation       15
                     /gene="MIR5695"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2145989409"
     variation       20
                     /gene="MIR5695"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2512604630"
     variation       25
                     /gene="MIR5695"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1296320713"
     variation       27
                     /gene="MIR5695"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1971234704"
     variation       29
                     /gene="MIR5695"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1379485471"
     variation       31..36
                     /gene="MIR5695"
                     /replace="ct"
                     /replace="ctctct"
                     /db_xref="dbSNP:1971234769"
     variation       35
                     /gene="MIR5695"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395665118"
     variation       37
                     /gene="MIR5695"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1449895898"
     variation       41
                     /gene="MIR5695"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1391532026"
     variation       45
                     /gene="MIR5695"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1971234893"
     variation       49
                     /gene="MIR5695"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1332036904"
     variation       51
                     /gene="MIR5695"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1971234948"
     variation       52
                     /gene="MIR5695"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1971234977"
     variation       53
                     /gene="MIR5695"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:530483426"
     ncRNA           54..75
                     /ncRNA_class="miRNA"
                     /gene="MIR5695"
                     /product="hsa-miR-5695"
                     /db_xref="miRBase:MIMAT0022488"
                     /db_xref="GeneID:100847016"
                     /db_xref="HGNC:HGNC:43548"
                     /db_xref="miRBase:MI0019302"
     variation       57
                     /gene="MIR5695"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1568441971"
     variation       61
                     /gene="MIR5695"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:905724094"
     variation       65..66
                     /gene="MIR5695"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:2512604654"
     variation       65
                     /gene="MIR5695"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1243937726"
     variation       66
                     /gene="MIR5695"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2145989454"
     variation       67
                     /gene="MIR5695"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1473832178"
     variation       69..77
                     /gene="MIR5695"
                     /replace=""
                     /replace="tagacagat"
                     /db_xref="dbSNP:2512604666"
     variation       69
                     /gene="MIR5695"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:935833976"
     variation       70
                     /gene="MIR5695"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1971235220"
     variation       73
                     /gene="MIR5695"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1180242511"
     variation       74..79
                     /gene="MIR5695"
                     /replace="ag"
                     /replace="agatag"
                     /db_xref="dbSNP:1971235313"
     variation       74
                     /gene="MIR5695"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1971235276"
     variation       77
                     /gene="MIR5695"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2967897"
     variation       79
                     /gene="MIR5695"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1416254898"
     variation       81
                     /gene="MIR5695"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:969850865"
     variation       82
                     /gene="MIR5695"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2512604685"
     variation       83
                     /gene="MIR5695"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1971235892"
     variation       85
                     /gene="MIR5695"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1971235917"
ORIGIN      
caaggcctatctatctagattcttcttggcctctctgagcatgcattcctgagactccaagaagaatctagacagataggccttg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]