ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-09-30 11:13:54, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NR_049880 85 bp RNA linear PRI 03-SEP-2020
DEFINITION Homo sapiens microRNA 5695 (MIR5695), microRNA.
ACCESSION NR_049880
VERSION NR_049880.1
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 85)
AUTHORS Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout
PW and Wang Y.
TITLE MicroRNAs associated with metastatic prostate cancer
JOURNAL PLoS ONE 6 (9), e24950 (2011)
PUBMED 21980368
REFERENCE 2 (bases 1 to 85)
AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
AJ.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res. 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from AC092069.2.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-85 AC092069.2 69273-69357 c
FEATURES Location/Qualifiers
source 1..85
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="19"
/map="19p13.13"
gene 1..85
/gene="MIR5695"
/note="microRNA 5695"
/db_xref="GeneID:100847016"
/db_xref="HGNC:HGNC:43548"
/db_xref="miRBase:MI0019302"
precursor_RNA 1..85
/gene="MIR5695"
/product="microRNA 5695"
/db_xref="GeneID:100847016"
/db_xref="HGNC:HGNC:43548"
/db_xref="miRBase:MI0019302"
exon 1..85
/gene="MIR5695"
/inference="alignment:Splign:2.1.0"
variation 1
/gene="MIR5695"
/replace="c"
/replace="t"
/db_xref="dbSNP:1971234353"
variation 2..3
/gene="MIR5695"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1971234376"
variation 4
/gene="MIR5695"
/replace="a"
/replace="g"
/db_xref="dbSNP:1971234406"
variation 7..17
/gene="MIR5695"
/replace="ctatcta"
/replace="ctatctatcta"
/db_xref="dbSNP:1208148129"
variation 7
/gene="MIR5695"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1322847755"
variation 8
/gene="MIR5695"
/replace="c"
/replace="t"
/db_xref="dbSNP:974114649"
variation 9
/gene="MIR5695"
/replace="a"
/replace="g"
/db_xref="dbSNP:1220965266"
variation 10
/gene="MIR5695"
/replace="c"
/replace="t"
/db_xref="dbSNP:1316510126"
variation 11
/gene="MIR5695"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1295330475"
variation 12
/gene="MIR5695"
/replace="g"
/replace="t"
/db_xref="dbSNP:1599647440"
variation 13
/gene="MIR5695"
/replace="a"
/replace="g"
/db_xref="dbSNP:1208352537"
variation 15
/gene="MIR5695"
/replace="c"
/replace="g"
/db_xref="dbSNP:2145989409"
variation 20
/gene="MIR5695"
/replace="c"
/replace="t"
/db_xref="dbSNP:2512604630"
variation 25
/gene="MIR5695"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1296320713"
variation 27
/gene="MIR5695"
/replace="c"
/replace="t"
/db_xref="dbSNP:1971234704"
variation 29
/gene="MIR5695"
/replace="a"
/replace="g"
/db_xref="dbSNP:1379485471"
variation 31..36
/gene="MIR5695"
/replace="ct"
/replace="ctctct"
/db_xref="dbSNP:1971234769"
variation 35
/gene="MIR5695"
/replace="c"
/replace="t"
/db_xref="dbSNP:1395665118"
variation 37
/gene="MIR5695"
/replace="a"
/replace="g"
/db_xref="dbSNP:1449895898"
variation 41
/gene="MIR5695"
/replace="a"
/replace="g"
/db_xref="dbSNP:1391532026"
variation 45
/gene="MIR5695"
/replace=""
/replace="a"
/db_xref="dbSNP:1971234893"
variation 49
/gene="MIR5695"
/replace="a"
/replace="c"
/db_xref="dbSNP:1332036904"
variation 51
/gene="MIR5695"
/replace="g"
/replace="t"
/db_xref="dbSNP:1971234948"
variation 52
/gene="MIR5695"
/replace="a"
/replace="c"
/db_xref="dbSNP:1971234977"
variation 53
/gene="MIR5695"
/replace="a"
/replace="g"
/db_xref="dbSNP:530483426"
ncRNA 54..75
/ncRNA_class="miRNA"
/gene="MIR5695"
/product="hsa-miR-5695"
/db_xref="miRBase:MIMAT0022488"
/db_xref="GeneID:100847016"
/db_xref="HGNC:HGNC:43548"
/db_xref="miRBase:MI0019302"
variation 57
/gene="MIR5695"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1568441971"
variation 61
/gene="MIR5695"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:905724094"
variation 65..66
/gene="MIR5695"
/replace=""
/replace="aa"
/db_xref="dbSNP:2512604654"
variation 65
/gene="MIR5695"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1243937726"
variation 66
/gene="MIR5695"
/replace="a"
/replace="c"
/db_xref="dbSNP:2145989454"
variation 67
/gene="MIR5695"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1473832178"
variation 69..77
/gene="MIR5695"
/replace=""
/replace="tagacagat"
/db_xref="dbSNP:2512604666"
variation 69
/gene="MIR5695"
/replace="c"
/replace="t"
/db_xref="dbSNP:935833976"
variation 70
/gene="MIR5695"
/replace="a"
/replace="c"
/db_xref="dbSNP:1971235220"
variation 73
/gene="MIR5695"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1180242511"
variation 74..79
/gene="MIR5695"
/replace="ag"
/replace="agatag"
/db_xref="dbSNP:1971235313"
variation 74
/gene="MIR5695"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1971235276"
variation 77
/gene="MIR5695"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:2967897"
variation 79
/gene="MIR5695"
/replace="c"
/replace="g"
/db_xref="dbSNP:1416254898"
variation 81
/gene="MIR5695"
/replace="c"
/replace="g"
/db_xref="dbSNP:969850865"
variation 82
/gene="MIR5695"
/replace="c"
/replace="g"
/db_xref="dbSNP:2512604685"
variation 83
/gene="MIR5695"
/replace="c"
/replace="t"
/db_xref="dbSNP:1971235892"
variation 85
/gene="MIR5695"
/replace="a"
/replace="g"
/db_xref="dbSNP:1971235917"
ORIGIN
caaggcctatctatctagattcttcttggcctctctgagcatgcattcctgagactccaagaagaatctagacagataggccttg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]