2024-04-28 20:24:01, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_039872 89 bp RNA linear PRI 19-SEP-2021 DEFINITION Homo sapiens microRNA 4721 (MIR4721), microRNA. ACCESSION NR_039872 VERSION NR_039872.1 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 89) AUTHORS Zhao M, Tang Z, Wang Y, Ding J, Guo Y and Gao T. TITLE A direct negative feedback loop of miR-4721/FOXA1/Nanog promotes nasopharyngeal cell stem cell enrichment and metastasis JOURNAL J Transl Med 19 (1), 387 (2021) PUBMED 34503528 REMARK GeneRIF: A direct negative feedback loop of miR-4721/FOXA1/Nanog promotes nasopharyngeal cell stem cell enrichment and metastasis. Publication Status: Online-Only REFERENCE 2 (bases 1 to 89) AUTHORS Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A and Rovira C. TITLE Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene JOURNAL Cancer Res 71 (1), 78-86 (2011) PUBMED 21199797 REFERENCE 3 (bases 1 to 89) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from AC133550.2. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-89 AC133550.2 43835-43923 FEATURES Location/Qualifiers source 1..89 /organism="Homo sapiens" /mol_type="transcribed RNA" /db_xref="taxon:9606" /chromosome="16" /map="16p11.2" gene 1..89 /gene="MIR4721" /note="microRNA 4721" /db_xref="GeneID:100616256" /db_xref="HGNC:HGNC:41609" /db_xref="miRBase:MI0017356" precursor_RNA 1..89 /gene="MIR4721" /product="microRNA 4721" /db_xref="GeneID:100616256" /db_xref="HGNC:HGNC:41609" /db_xref="miRBase:MI0017356" exon 1..89 /gene="MIR4721" /inference="alignment:Splign:2.1.0" variation 2 /gene="MIR4721" /replace="a" /replace="g" /db_xref="dbSNP:1341977800" variation 5 /gene="MIR4721" /replace="c" /replace="g" /db_xref="dbSNP:1961865858" variation 6 /gene="MIR4721" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:760049967" variation 7 /gene="MIR4721" /replace="c" /replace="g" /db_xref="dbSNP:1460882262" variation 9 /gene="MIR4721" /replace="g" /replace="t" /db_xref="dbSNP:1395175547" variation 11 /gene="MIR4721" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:775054744" variation 12 /gene="MIR4721" /replace="c" /replace="t" /db_xref="dbSNP:1961865479" variation 14 /gene="MIR4721" /replace="a" /replace="g" /db_xref="dbSNP:1961865409" variation 15 /gene="MIR4721" /replace="c" /replace="t" /db_xref="dbSNP:1338038515" variation 22 /gene="MIR4721" /replace="a" /replace="g" /db_xref="dbSNP:1961865274" variation 24 /gene="MIR4721" /replace="a" /replace="g" /db_xref="dbSNP:879136759" variation 28 /gene="MIR4721" /replace="c" /replace="t" /db_xref="dbSNP:1961865156" variation 29 /gene="MIR4721" /replace="a" /replace="g" /db_xref="dbSNP:767003495" variation 31 /gene="MIR4721" /replace="c" /replace="g" /db_xref="dbSNP:1961864945" variation 32 /gene="MIR4721" /replace="a" /replace="g" /db_xref="dbSNP:140375296" variation 33 /gene="MIR4721" /replace="a" /replace="g" /db_xref="dbSNP:774039518" variation 37 /gene="MIR4721" /replace="c" /replace="t" /db_xref="dbSNP:1450884426" variation 39 /gene="MIR4721" /replace="a" /replace="g" /db_xref="dbSNP:771236414" variation 43 /gene="MIR4721" /replace="a" /replace="g" /db_xref="dbSNP:756548108" variation 46 /gene="MIR4721" /replace="a" /replace="g" /db_xref="dbSNP:1279424445" variation 52 /gene="MIR4721" /replace="a" /replace="g" /db_xref="dbSNP:1961864487" variation 53 /gene="MIR4721" /replace="g" /replace="t" /db_xref="dbSNP:1961864439" variation 55 /gene="MIR4721" /replace="c" /replace="t" /db_xref="dbSNP:749683561" ncRNA 60..81 /ncRNA_class="miRNA" /gene="MIR4721" /product="hsa-miR-4721" /db_xref="miRBase:MIMAT0019835" /db_xref="GeneID:100616256" /db_xref="HGNC:HGNC:41609" /db_xref="miRBase:MI0017356" variation 61..63 /gene="MIR4721" /replace="g" /replace="gag" /db_xref="dbSNP:1468516587" variation 63 /gene="MIR4721" /replace="a" /replace="g" /db_xref="dbSNP:1961864256" variation 65 /gene="MIR4721" /replace="c" /replace="g" /db_xref="dbSNP:1441852546" variation 67 /gene="MIR4721" /replace="g" /replace="t" /db_xref="dbSNP:568012742" variation 68 /gene="MIR4721" /replace="c" /replace="t" /db_xref="dbSNP:1224416950" variation 69 /gene="MIR4721" /replace="c" /replace="t" /db_xref="dbSNP:770346107" variation 70 /gene="MIR4721" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:748657714" variation 72 /gene="MIR4721" /replace="c" /replace="g" /db_xref="dbSNP:781324296" variation 76 /gene="MIR4721" /replace="c" /replace="t" /db_xref="dbSNP:372032229" variation 77 /gene="MIR4721" /replace="a" /replace="g" /db_xref="dbSNP:548287959" variation 79 /gene="MIR4721" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:780459003" variation 81 /gene="MIR4721" /replace="a" /replace="g" /db_xref="dbSNP:1392691829" variation 82 /gene="MIR4721" /replace="a" /replace="g" /db_xref="dbSNP:367961753" variation 83 /gene="MIR4721" /replace="c" /replace="t" /db_xref="dbSNP:753683624" variation 86 /gene="MIR4721" /replace="a" /replace="g" /db_xref="dbSNP:1961862813" variation 88 /gene="MIR4721" /replace="c" /replace="t" /db_xref="dbSNP:777489248" variation 89 /gene="MIR4721" /replace="a" /replace="t" /db_xref="dbSNP:756076573" ORIGIN
gggcctggtcatggtcaagccaggttccatcaagccccaccagaaggtggaggcccaggtgagggctccaggtgacggtgggcagggtt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]